Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood
YE Juan, YE Feng, HOU Ling, WU Wei, LUO Xiao-Ping, LIANG Yan
Department of Pediatrics, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology/Hubei Key Laboratory of Pediatric Genetic Metabolic and Endocrine Rare Diseases, Wuhan 430030, China
Abstract Objective To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. Methods A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. Results All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. Conclusions This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
YE Juan,YE Feng,HOU Ling et al. Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood[J]. CJCP, 2025, 27(1): 94-100.
YE Juan,YE Feng,HOU Ling et al. Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood[J]. CJCP, 2025, 27(1): 94-100.
Shields BM, Hicks S, Shepherd MH, et al. Maturity-onset diabetes of the young (MODY): how many cases are we missing?[J]. Diabetologia, 2010, 53(12): 2504-2508. PMID: 20499044. DOI: 10.1007/s00125-010-1799-4.
Richards S, Aziz N, Bale S, et al. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med, 2015, 17(5): 405-424. PMID: 25741868. PMCID: PMC4544753. DOI: 10.1038/gim. 2015.30.
Kawakita R, Hosokawa Y, Fujimaru R, et al. Molecular and clinical characterization of glucokinase maturity-onset diabetes of the young (GCK-MODY) in Japanese patients[J]. Diabet Med, 2014, 31(11): 1357-1362. PMID: 24804978. DOI: 10.1111/dme.12487.
Lopez AP, de Dios A, Chiesa I, et al. Analysis of mutations in the glucokinase gene in people clinically characterized as MODY2 without a family history of diabetes[J]. Diabetes Res Clin Pract, 2016, 118: 38-43. PMID: 27289208. DOI: 10.1016/j.diabres.2016.04.057.
Steele AM, Shields BM, Wensley KJ, et al. Prevalence of vascular complications among patients with glucokinase mutations and prolonged, mild hyperglycemia[J]. JAMA, 2014, 311(3): 279-286. PMID: 24430320. DOI: 10.1001/jama.2013.283980.
Bergman M, Manco M, Satman I, et al. International diabetes federation position statement on the 1-hour post-load plasma glucose for the diagnosis of intermediate hyperglycaemia and type 2 diabetes[J]. Diabetes Res Clin Pract, 2024, 209: 111589. PMID: 38458916. DOI: 10.1016/j.diabres.2024.111589.
Timsit J, Ciangura C, Dubois-Laforgue D, et al. Pregnancy in women with monogenic diabetes due to pathogenic variants of the glucokinase gene: lessons and challenges[J]. Front Endocrinol (Lausanne), 2022, 12: 802423. PMID: 35069449. PMCID: PMC8766338. DOI: 10.3389/fendo.2021.802423.
Aarthy R, Aston-Mourney K, Mikocka-Walus A, et al. Clinical features, complications and treatment of rarer forms of maturity-onset diabetes of the young (MODY): a review[J]. J Diabetes Complications, 2021, 35(1): 107640. PMID: 32763092. DOI: 10.1016/j.jdiacomp.2020.107640.
Elias-Assad G, Saab R, Molnes J, et al. Maturity onset diabetes of the young type 2 (MODY2): insight from an extended family[J]. Diabetes Res Clin Pract, 2021, 175: 108791. PMID: 33812904. DOI: 10.1016/j.diabres.2021.108791.
