Objective To investigate the efficacy and safety of exchange transfusion in neonates with severe pertussis. Methods A retrospective analysis was performed for the medical data of five neonates with severe pertussis who underwent exchange transfusion in the Department of Neonatology, Hunan Children's Hospital, from August 2019 to March 2024. The clinical characteristics of the patients were summarized, and the efficacy and adverse reactions of exchange transfusion were analyzed. Results All five neonates had the symptoms of hypoxemia, recurrent apnea, and heart failure and required invasive mechanical ventilation. Two cases of pulmonary hypertension were observed, one of which was complicated by decompensated shock. Before exchange transfusion, the five children had a median leukocyte count of 82.60×10⁹/L, a median absolute lymphocyte count of 28.20×10⁹/L, and a median absolute neutrophil count of 43.10×10⁹/L, and reexamination at 4 hours after exchange transfusion showed that these values decreased to 28.40×10⁹/L, 7.60×10⁹/L, and 15.40×10⁹/L, respectively. The four children who underwent exchange transfusion in the early stage of cardiopulmonary failure showed varying degrees of improvement in oxygenation and a reduction in the partial pressure of carbon dioxide, and they were discharged after improvement; the one child who underwent exchange transfusion in the late stage of cardiopulmonary failure ultimately died. No child experienced severe adverse reactions related to exchange transfusion. Conclusions For neonates with severe pertussis, initiating exchange transfusion in the early stages of cardiopulmonary failure can effectively reduce leukocyte levels, potentially improve survival rates, and is relatively safe.

To guide clinical blood transfusion practices for pediatric patients, the National Health Commission has issued the health standard "Guideline for pediatric transfusion" (WS/T 795-2022). Blood transfusion is one of the most commonly used supportive treatments for children with hematological diseases. This guideline provides guidance and recommendations for blood transfusions in children with aplastic anemia, thalassemia, autoimmune hemolytic anemia, glucose-6-phosphate dehydrogenase deficiency, acute leukemia, myelodysplastic syndromes, immune thrombocytopenic purpura, and thrombotic thrombocytopenic purpura. This article presents the evidence and interpretation of the blood transfusion provisions for children with hematological diseases in the "Guideline for pediatric transfusion", aiming to assist in the understanding and implementing the blood transfusion section of this guideline.

There is a delay in the clinical diagnosis of Turner syndrome (TS), particularly for patients with mosaic karyotypes. This diagnostic delay can hinder age-appropriate treatments and lead to adverse health outcomes. Therefore, it is necessary to explore improvement measures for early diagnosis and treatment plans based on the current clinical situation. Furthermore, as research progresses, the focus of clinical diagnosis and treatment of TS is gradually expanding to multiple aspects, including cardiovascular health, fertility, and transitional care, in order to improve the prognosis and quality of life of the patients. This paper discusses the current clinical status and management key points of TS diagnosis and treatment, aiming to provide insights for improving the management of TS.

A female infant, aged 11 days, was admitted due to dyspnea for 11 days after birth, with the main clinical manifestations of inspiratory dyspnea, feeding difficulties, and unusual facies (micrognathia, high palatal arch, cleft palate, glossoptosis, and oblique mouth to the right), and the preliminary diagnosis was Pierre-Robin syndrome. There was no marked improvement after treatment such as ventilator-assisted ventilation, nutrition, and surgical ligation of patent ductus arteriosus. Whole-exome sequencing of the family showed a heterozygous mutation of c.3082A>G (p.Ile1028 Val) in the CHD7 gene, which was a pathogenic mutation of CHARGE syndrome. The neonate was ultimately diagnosed with CHARGE syndrome, and the family decided to withdraw treatment due to concerns about poor prognosis. This article reports a case of CHARGE syndrome caused by a mutation in the CHD7 gene and the multidisciplinary diagnosis and treatment of this disease, in order to provide help for early disease identification and guide clinical decision-making.

This paper comprehensively compares the Kawasaki disease (KD) guidelines from seven countries/regions, including China, Argentina, Europe, Italy, Japan, Spain, and the United States, as retrieved from the PubMed database. It analyzes the similarities and differences in KD diagnosis and treatment among these guidelines. The results show that all guidelines consistently recommend a single infusion of immunoglobulin at a dosage of 2 g/kg as the first-line treatment for KD, and none advocate for the routine use of methylprednisolone or prednisone as standalone first-line treatment options for KD. However, there are some differences among the guidelines regarding classification, diagnostic criteria, and specific treatment methods for KD. Therefore, it is essential to further strengthen international collaboration in guideline development and conduct multicenter clinical research in the future, aiming to achieve a higher level of expert consensus, thereby promoting the enhancement of KD diagnosis and treatment.

Objective To investigate the epidemiological characteristics and changing trends of communicable diseases among children and adolescents in China from 1990 to 2021. Methods Based on the Global Burden of Disease Database, epidemiological indicators for communicable diseases among the population aged under 20 years in China from 1990 to 2021 were selected to analyze the burden of communicable diseases in this population, and a comparative analysis was performed with global data as well as data from Western Europe and North America. Results In 1990-2021, the overall burden of communicable diseases tended to decrease among children and adolescents in China. In 2021, the prevalence rate of communicable diseases in China was lower than the global prevalence rate and was higher than that in Western Europe and North America. There was a significant reduction in the mortality rate of communicable diseases, and the gap with Western Europe and North America gradually narrowed year by year. The overall incidence rate, mortality rate, and disability-adjusted life year rate of communicable diseases in males were higher than those in females, and respiratory infections and intestinal infections were more common in children aged <5 years, while the incidence rate of sexually transmitted diseases was higher in adolescents. Conclusions From 1990 to 2021, the disease burden of communicable diseases among the population under 20 years old in China has significantly decreased. However, there is still a certain gap compared to developed regions. Strengthening the prevention and control of diseases such as respiratory infections and acquired immunodeficiency syndrome, as well as enhancing health interventions for children under 5 years old, will help improve the overall health level of children and adolescents in China.

Objective To detect multidrug resistance gene locus mutations in children with Mycoplasma pneumoniae pneumonia through targeted high-throughput sequencing and to explore its clinical significance. Methods A retrospective analysis was conducted on the clinical data of 2 899 children with Mycoplasma pneumoniae pneumonia, who underwent respiratory pathogen-targeted high-throughput sequencing, treated at Hubei Maternal and Child Health Care Hospital between January and December 2023. The patients were divided into a mutation group (n=885) and a non-mutation group (n=2 014) based on whether there was a mutation in the 23SrRNA macrolide-resistant gene of Mycoplasma pneumoniae. Multivariate logistic regression analysis was used to investigate the risk factors for multidrug resistance gene locus mutations in children with Mycoplasma pneumoniae pneumonia. Results Among the 2 899 children, 885 cases (30.53%) had mutations in the 23SrRNA resistance gene, including 884 cases with the A2063G mutation and 1 case with the A2064G mutation. In children with 23SrRNA resistance gene mutations, treatment with doxycycline or ofloxacin was more effective than with azithromycin or clarithromycin, and doxycycline was more effective than ofloxacin (P<0.05). The mutation rate of resistance genes in children with Mycoplasma pneumoniae pneumonia increased with age (P<0.001). Multivariate logistic regression analysis showed that increased age, extrapulmonary infection, lung consolidation, prolonged fever, prolonged hospitalization, and elevated CRP levels were risk factors for 23SrRNA gene locus mutations (P<0.05). Conclusions Age, extrapulmonary infections, lung consolidation, duration of fever, length of hospitalization, and CRP levels are closely related to 23SrRNA resistance gene locus mutations. Detecting multidrug resistance gene locus mutations in children with Mycoplasma pneumoniae pneumonia can aid in early diagnosis and prediction of treatment efficacy, promoting rational clinical treatment.

Objective To investigate the risk factors for bronchopulmonary dysplasia (BPD) in preterm infants, and to establish a risk prediction model. Methods A total of 120 preterm infants who were admitted to the neonatal intensive care unit of Shanghai Children's Hospital from January to December 2022 were included. According to the diagnostic criteria for BPD released by the National Institute of Child Health and Human Development in 2018, they were divided into a non-BPD group (84 infants) and a BPD group (36 infants). The clinical data of the infants and their mothers were compared between the two groups. The univariate analysis and the stepwise multivariate regression analysis were used to identify the risk factors for BPD and establish a risk prediction model. Results The results showed that a gestational age of <28 weeks, duration of noninvasive respiratory support, comorbidity with infectious pneumonia, and chorioamnionitis in the mother were independent risk factors for BPD in preterm infants (P<0.05). A nomogram model for predicting the development of BPD was established based on the risk factors, with an area under the receiver operating characteristic curve of 0.93, and the calibration curve of this nomogram had a slope of about 1. The goodness-of-fit test indicated the model fitted well (χ²=8.287, P=0.406). Conclusions A gestational age of <28 weeks, duration of noninvasive respiratory support, comorbidity with infectious pneumonia, and chorioamnionitis in the mother are independent risk factors for BPD in preterm infants.

Patients with Noonan syndrome (NS) are born with normal or slightly lower body length and weight compared to the normal ranges. However, their height gradually falls behind that of the general population, leading to growth retardation and delayed puberty. In China, the incidence of short stature in patients with NS is approximately 65%. Short stature in these patients arises from multiple causes, including feeding difficulties in infancy, comorbidities such as congenital heart disease, genetic heterogeneity, and disorders of the growth hormone/insulin-like growth factor-1 axis. Growth hormone is commonly used to alleviate symptoms of short stature. This article reviews the growth and development patterns at different stages of NS, analyzes the causes of short stature, and summarizes the latest advances in treatment to provide new insights for the diagnosis and management of short stature in patients with NS.

Objective To study the risk factors for hypoxemia in children with severe Mycoplasma pneumoniae pneumonia (SMPP). Methods A retrospective collection of clinical data from children diagnosed with SMPP at the Third Affiliated Hospital of Zhengzhou University from June to December 2023 was conducted. The patients were categorized into hypoxemia and non-hypoxemia groups. Logistic regression analysis was used to assess the risk factors for hypoxemia, and receiver operating characteristic (ROC) curve analysis was employed to analyze the diagnostic performance of various indicators. Results A total of 113 children with SMPP were included. Univariate logistic regression analysis showed that ferritin, aspartate aminotransferase, creatinine, creatine kinase isoenzyme, lactate dehydrogenase, alpha-hydroxybutyrate dehydrogenase, immunoglobulin G, complement C3, complement C4, age, extrapulmonary complications, and a chest computed tomography (CT) scan showing a bronchiolitis pattern were significant factors for hypoxemia in children with SMPP (P<0.05). Multivariate logistic regression analysis revealed that elevated ferritin levels, presence of extrapulmonary complications, and a bronchiolitis pattern on lung CT were independent risk factors for hypoxemia in these patients (P<0.05). The ROC curve analysis indicated that the combination of these three indicators for predicting hypoxemia had a sensitivity of 71.9%, a specificity of 95.1%, and an area under the curve of 0.888 (95%CI: 0.809-0.968). Conclusions In children with SMPP, when there are elevated ferritin levels, a bronchiolitis pattern on chest CT, and the presence of extrapulmonary complications, there should be a high level of vigilance for the potential development of hypoxemia.

Objective To establish the pharmacokinetic model of linezolid in neonates, and to optimize the administration regimen. Methods A prospective study was conducted among 64 neonates with sepsis who received linezolid as anti-infective therapy, and liquid chromatography-tandem mass spectrometry was used to measure the plasma concentration of the drug. Clinical data were collected, and nonlinear mixed effects modeling was used to establish a population pharmacokinetic (PPK) model. Monte Carlo simulation and evaluation was performed for the optimal administration regimen of children with different features. Results The pharmacokinetic properties of linezolid in neonates could be described by a single-compartment model with primary elimination, and the population typical values for apparent volume of distribution and clearance rate were 0.79 L and 0.34 L/h, respectively. The results of goodness of fit, visualization verification, and the Bootstrap method showed that the model was robust with reliable results of parameter estimation and prediction. Monte Carlo simulation results showed that the optimal administration regimen for linezolid in neonates was as follows: 6 mg/kg, q8h, at 28 weeks of gestational age (GA); 8 mg/kg, q8h, at 32 weeks of GA; 9 mg/kg, q8h, at 34-37 weeks of GA; 11 mg/kg, q8h, at 40 weeks of GA. Conclusions The PPK model established in this study can provide a reference for individual administration of linezolid in neonates. GA and body weight at the time of administration are significant influencing factors for the clearance rate of linezolid in neonates.

Objective To investigate the efficacy and safety of perampanel (PER) add-on therapy in children with epilepsy of genetic etiology. Methods A retrospective analysis was conducted on the clinical data of 53 children who attended the Department of Neurology, Wuhan Children's Hospital, from November 2020 to April 2023. All children received PER add-on therapy and were diagnosed with epilepsy of genetic etiology based on whole-exome sequencing. The primary outcome measure was the proportion of children with a reduction in seizure frequency of ≥50% at month 12 of PER treatment (i.e., response rate), and the secondary outcome measures were response rates at months 3 and 6 of treatment. The influencing factors for the efficacy of PER add-on therapy in the treatment of epilepsy of genetic etiology were analyzed, and adverse events were recorded. Results The median follow-up duration was 13.10 months. After 12 months of follow-up, 42 children were included in the analysis, comprising 25 boys (60%) and 17 girls (40%). The median initial dose of PER was 1.5 (1.0, 2.0) mg/d, and the median maintenance dose was 4.0 (3.0, 8.0) mg/d. The response rates to PER at months 3, 6, and 12 of treatment were 61% (30/49), 54% (25/46), and 48% (20/42), respectively. No significant difference in the efficacy of PER was observed between children with mutations in genes encoding different protein functions (P>0.05). The most common adverse event reported was fatigue, observed in 3 children (6%). Conclusions PER add-on therapy demonstrates good efficacy and safety in children with epilepsy of genetic etiology. No influencing factors for the efficacy of PER have been identified to date.

Thrombocytosis is a common condition in children, classified into primary and secondary types. Secondary thrombocytosis is mainly caused by factors such as infection, anemia, iron deficiency, trauma, or surgical intervention, and it typically occurs without severe thrombosis or bleeding events. Platelet counts can return to normal after control of the primary factors, with favorable clinical outcomes. Primary thrombocytosis is mainly caused by myeloproliferative neoplasms such as polycythemia vera, essential thrombocythemia, and myelofibrosis, often accompanied by gene mutations in hematopoietic cells. In children, clinical manifestations are atypical compared to adults, with few thromboembolic or bleeding events. No special treatment is required for patients who are asymptomatic or have mild symptoms, and it is recommended to regularly monitor platelet counts. Antiplatelet therapy with aspirin can be considered for patients at risk of thrombosis or those with extreme thrombocytosis, and cytoreductive therapy can be performed when necessary, but the toxicities and side effects of drugs should be closely monitored. At present, hydroxyurea, interferon-alpha, and anagrelide are commonly used for cytoreductive therapy. This article provides an overview of the etiology, classification, clinical manifestations, diagnosis, and treatment of childhood thrombocytosis to guide healthcare professionals in treatment decisions.

Objective To explore the application of the colloidal gold method and chemiluminescence method in detecting gonadotropin (Gn) in morning urine for assessing pubertal development status in children. Methods A total of 132 children diagnosed with central precocious puberty (CPP), early and fast puberty (EFP), and premature thelarche (PT) at Ruijin Hospital Affiliated to Shanghai Jiao Tong University School of Medicine from November 2021 to December 2022 were included, along with 685 healthy children who underwent routine health examinations at the hospital's pediatric health care department during the same period. All 132 patients underwent a gonadotropin-releasing hormone (GnRH) stimulation test. Both patients and healthy children had their urinary Gn levels measured using the colloidal gold method and chemiluminescence method, including levels of luteinizing hormone (LH) and follicle-stimulating hormone (FSH). The correlation between serum Gn and urinary Gn detected by the two methods, as well as the correlation between Tanner stages of healthy children and urinary Gn, was analyzed. Results Urine Gn levels detected by both the colloidal gold method and chemiluminescence method showed a positive correlation with serum LH baseline values, LH peak values, baseline LH/FSH ratios, and peak LH/FSH ratios (P<0.05). In healthy children, urinary LH levels detected by the chemiluminescence method gradually increased from Tanner stage Ⅰ to Ⅳ (P<0.05), while urinary FSH levels were lower in Tanner stage I than in stages Ⅱ, Ⅲ, and IV (P<0.05). Urinary LH levels detected by the colloidal gold method were lower in Tanner stage I compared to stages Ⅱ, Ⅲ, and IV, with the highest levels observed in Tanner stage Ⅳ (P<0.05). Additionally, urinary FSH levels in Tanner stage Ⅲ were higher than in stages Ⅰ and Ⅱ (P<0.05). The area under the receiver operating characteristic curve for evaluating Tanner stages I and II in healthy children using urinary LH and FSH levels by the chemiluminescence method and urinary LH levels by the colloidal gold method were 0.730, 0.699, and 0.783, respectively. Conclusions The colloidal gold method and chemiluminescence method for detecting Gn in morning urine show good correlation with serum Gn levels. As a non-invasive and convenient detection method, the colloidal gold method can serve as a useful tool for screening the onset of pubertal development in children.

Objective To investigate the expression levels of ghrelin and liver-expressed antimicrobial peptide-2 (LEAP-2) in children with idiopathic short stature (ISS) to provide reference for further understanding the etiology of short stature. Methods A prospective study was conducted from December 2021 to October 2023, involving 46 children diagnosed with ISS (ISS group) and 46 healthy children with normal height (control group) at the First Affiliated Hospital of Shihezi University. General data and serum levels of ghrelin and LEAP-2 were compared between the two groups. The predictive value of these two indicators for ISS was evaluated using receiver operating characteristic (ROC) curve analysis. Results The serum level of ghrelin in the ISS group was higher than that in the control group, while the level of LEAP-2 was lower (P<0.05). The ratio of LEAP-2 to ghrelin was lower in the ISS group compared to the control group (P<0.05). Multivariate logistic regression analysis showed that HtSDS, IGF-1, ghrelin, LEAP-2, and the ratio of LEAP-2/ghrelin were independently associated with the occurrence of ISS (P<0.05). ROC curve analysis indicated that the AUCs for ghrelin, LEAP-2, the ratio of ghrelin to LEAP-2, and their combination in predicting ISS were all >0.8. The optimal cutoff values for ghrelin, LEAP-2, and the LEAP-2/ghrelin ratio were 5 607 pg/mL, 1 155 pg/mL, and 0.212, respectively. In children with ISS, ghrelin showed a negative correlation with chronological age, LEAP-2, and the LEAP-2/ghrelin ratio (P<0.05), while it was positively correlated with growth rate and peak growth hormone levels (P<0.05). LEAP-2 was negatively correlated with growth rate, peak growth hormone levels, and ghrelin (P<0.05), but positively correlated with chronological age and the LEAP-2/ghrelin ratio (P<0.05). Conclusions Ghrelin and LEAP-2 are correlated with the occurrence of ISS, which may provide references for the diagnosis and etiological analysis of children with ISS.

Objective To systematically review the methodological quality and measurement properties of childhood cancer-related fatigue assessment tools based on the consensus-based standards for the selection of health measurement instruments (COSMIN) guidelines, providing a basis for clinical practitioners to select appropriate assessment tools. Methods The databases searched included China National Knowledge Infrastructure, Wanfang Data, China Biomedical Literature, Weipu, PubMed, CINAHL, Embase, and Web of Science for studies published up to January 2024. Children under 12 years old and their primary caregivers were enrolled as subjects. Articles were screened based on inclusion criteria, and the key information regarding the assessment tools was extracted. The risk of bias checklist from the COSMIN guidelines and the quality standard rating scale were employed to evaluate measurement properties and formulate final recommendations. Results A total of 18 articles were included, covering 7 fatigue measurement tools, consisting of 4 specific tools and 3 generic tools tools. Methodological differences were observed in measurement properties across these scales. The Chinese Version of the Pediatric Patient-Reported Outcomes Measurement Information System (C-Ped-PROMIS) was rated as grade A recommendation due to its adequate content validity and internal consistency, while the remaining six scales were rated as grade B recommendation since their content validity was assessed as "insufficient" based on moderate-level evidence or higher. Conclusions The C-Ped-PROMIS scale demonstrates good reliability, validity, and cross-cultural validity as the preferred tool for measuring childhood cancer-related fatigue. The scale can serve as an auxiliary tool, and future research should focus on the applicability of various tools to enhance the effectiveness of interventions for assessing childhood cancer-related fatigue.

Objective To investigate the value of weight growth velocity, calculated using the Patel exponential model and the Z-score change method, in predicting the neurological and physical development outcomes of preterm infants with a gestational age of <30 weeks in the long term. Methods A retrospective study was conducted involving preterm infants with a gestational age of <30 weeks who were hospitalized and treated in the Department of Neonatology at Tongji Hospital, Huazhong University of Science and Technology, from January 2017 to June 2022, and were followed up at the outpatient service more than 18 months of age. The preterm infants were divided into high and low rate groups based on the two calculation methods, and the two methods were compared regarding their predictive value for neurological and physical development outcomes in the long term. Results The average age of the last follow-up was (23.0±3.6) months. For neurological development, according to the Patel exponential model, the low rate group exhibited a significantly higher abnormal rate in the fine motor domain compared to the high rate group (P<0.05). Using the Z-score change method, the low rate group had significantly higher abnormal rates in both gross motor and fine motor domains, and significantly lower developmental quotients for gross motor, fine motor, and adaptive behavior domains compared to the high rate group (P<0.05). For physical development, there were no significant differences in body length, body weight, head circumference, or the incidence rate of growth restriction between the low rate and high rate groups identified by either method (P>0.05). Conclusions Weight growth velocity calculated using the Z-score change method is more effective in predicting long-term neurological outcomes in preterm infants, while weight growth velocity derived from both methods shows no significant association with long-term physical development outcomes.

Objective To investigate the value of interrupter resistance (Rint) pulmonary function testing in the diagnosis of asthma in preschool children, and to compare the significance of Rint pulmonary function testing versus impulse oscillometry (IOS) in the diagnosis of asthma. Methods A prospective study was conducted among 108 children with recurrent wheezing, aged 4 to <6 years, who were admitted from July 2022 to November 2023. According to the treatment outcome, they were divided into an asthmatic group (61 children) and a non-asthmatic group (47 children). Rint pulmonary function parameters and IOS parameters were analyzed for both groups, and the two tests were compared in terms of feasibility and diagnostic value. Results Compared with the non-asthmatic group, the asthmatic group had significantly higher percentage of actual measured value to predicted value for Rint and percent changes in the measured value and predicted value of Rint (P<0.05). The receiver operating characteristic curve analysis showed that the percent change in the predicted value of Rint had an optimal cut-off value of 32.0% in the diagnosis of asthma in preschool children, with an area under the curve (AUC) of 0.705, a sensitivity of 41.0%, and a specificity of 91.5% (P<0.05). In terms of the degree of completion, 18 children (16.7%) failed to complete the IOS test, but they could successfully complete Rint pulmonary function testing with good quality control. Rint pulmonary function testing and IOS had a similar area under the curve in the diagnosis of asthma in preschool children (P>0.05). Conclusions Rint pulmonary function testing can be used to assist in the diagnosis of asthma in preschool children, with a similar diagnostic value to IOS and a relatively high level of feasibility. A percent change of ≥32% in the predicted value of Rint in the bronchial dilation test can be used as a cut-off value for the diagnosis of asthma in preschool children.

Objective To investigate the clinical characteristics of carbapenem-resistant Pseudomonas aeruginosa (CRPA) infection in children and the risk factors for such infection. Methods A retrospective analysis was conducted among 60 children with CRPA infection (CRPA group) who were hospitalized in Shenzhen Children's Hospital, China Medical University, from January 2018 to September 2023, and 82 children with carbapenem-sensitive Pseudomonas aeruginosa infection during the same period were randomly selected as the control group. A multivariate logistic regression analysis was used to investigate the risk factors for CRPA infection. Results Among the 60 children with CRPA infection, 31 (52%) were admitted to the intensive care unit (ICU), and the lower respiratory tract was the main detection site in 32 children (53%). The univariate analysis showed that sex, history of invasive treatment within 1 year, antibiotic use before admission, presence of underlying condition, ICU admission, invasive procedure after admission, antibiotic use for >14 days, and the type of antibiotics used of ≥3 were associated with CRPA infection (P<0.05). The multivariate logistic regression analysis showed that the history of invasive treatment within 1 year (OR=3.228, P<0.05), antibiotic use before admission (OR=4.052, P<0.05), antibiotic use for >14 days (OR=4.961, P<0.05), and the type of antibiotics used of ≥3 (OR=3.687, P<0.05) were independent risk factors for CRPA infection in children. Conclusions CRPA infection in children may be associated with a history of invasive treatment within the past year, antibiotic use before admission, duration of antibiotic use after admission, and the diversity of antibiotic types used.

Objective To evaluate the effect of colostrum oral immune therapy (COIT) on clinical outcomes in very low birth weight (VLBW) infants. Methods A computer-based search was conducted in databases including China National Knowledge Infrastructure, Wanfang Data, Weipu Database, Chinese Biomedical Literature Service System, PubMed, Embase, Web of Science, the Cochrane Library, and CINAHL for randomized controlled trials regarding the application of COIT in VLBW infants published from the establishment of the database to February 2024. Meta analysis was performed using RevMan 5.3 software. Results A total of 14 randomized controlled trials were included, involving 1 386 VLBW infants, with 690 in the COIT group and 696 in the control group. The results showed that COIT significantly reduced the incidence of clinical late-onset sepsis (LOS) (RR=0.75, 95%CI: 0.64-0.88, P<0.001), the incidence of blood culture-proven LOS (RR=0.72, 95%CI: 0.57-0.92, P=0.008), mortality rate (RR=0.70, 95%CI: 0.52-0.95, P=0.020), the incidence of necrotizing enterocolitis (RR=0.65, 95%CI: 0.46-0.92, P=0.020), and the incidence of feeding intolerance (RR=0.49, 95%CI: 0.29-0.80, P=0.004). It also shortened the time to achieve full enteral nutrition (MD=-2.13, 95%CI: -4.03 to -0.23, P=0.030). Conclusions COIT can reduce the incidence rates of LOS, necrotizing enterocolitis, and feeding intolerance, as well as the mortality rate, while also shortening the time to achieve full enteral nutrition in VLBW infants.

Objective To study the significance of serum 25-hydroxyvitamin D₃ [25-(OH)D₃] level in the clinicopathological characteristics and prognosis of children with immunoglobulin A vasculitis nephritis (IgAVN). Methods A retrospective analysis was conducted on the clinical data of children with IgAVN who underwent renal biopsy at Suzhou Hospital Affiliated to Anhui Medical University and Jinling Hospital of the Medical School of Nanjing University from June 2015 to June 2020. Based on serum 25-(OH)D₃ level, the patients were divided into a normal group and a lower group. The clinicopathological characteristics and follow-up data of the two groups were collected and compared. Results A total of 359 children with IgAVN were included. Compared to the normal group (62 cases), the lower group (297 cases) exhibited higher incidences of hematochezia and gross hematuria, higher levels of serum creatinine, blood urea nitrogen, urinary retinol protein, urinary N-acetyl-β-D-glucosaminidase, and quantitative urinary protein, and a longer duration from renal biopsy to urinary protein becoming negative, as well as lower estimated glomerular filtration rate and albumin level (P<0.05). Renal pathology in the lower group showed a higher occurrence of tubular interstitial injury, crescent formation, segmental sclerosis in glomeruli, and inflammatory cell infiltration in the renal interstitium compared to the normal group (P<0.05). Survival analysis indicated that the cumulative renal survival rate was lower in the lower group (P<0.05). Multivariate Cox regression analysis revealed that low serum 25-(OH)D₃ level is an independent risk factor for poor prognosis in children with IgAVN. Conclusions Children with IgAVN and low serum 25-(OH)D₃ level have relatively severe clinicopathological manifestations. Low serum 25-(OH)D₃ level is an independent risk factor for poor prognosis in children with IgAVN.

Objective To investigate the clinical characteristics and prognosis of acute erythroleukemia (AEL) in children. Methods A retrospective analysis was conducted on the clinical data, treatment, and prognosis of 8 children with AEL treated at the First Affiliated Hospital of Zhengzhou University from January 2013 to December 2023. Results Among the 7 patients with complete bone marrow morphological analysis, 4 exhibited trilineage dysplasia, with a 100% incidence of erythroid dysplasia (7/7), a 71% incidence of myeloid dysplasia (5/7), and a 57% incidence of megakaryocytic dysplasia (4/7). Immunophenotyping revealed that myeloid antigens were primarily expressed as CD13, CD33, CD117, CD38, and CD123, with 4 cases expressing erythroid antigens CD71 and 2 cases expressing CD235a. Chromosomal analysis indicated that 2 cases presented with abnormal karyotypes, including +8 in one case and +4 accompanied by +6 in another; no complex karyotypes were observed. Genetic abnormalities were detected in 4 cases, with fusion genes including one case each of dup MLL positive and EVI1 positive, as well as mutations involving KRAS, NRAS, WT1, and UBTF. Seven patients received chemotherapy, with 6 achieving remission after one course of treatment; 2 underwent hematopoietic stem cell transplantation, and all had disease-free survival. Follow-up (median follow-up time of 6 months) showed that only 3 patients survived (2 cases after hematopoietic stem cell transplantation and 1 case during treatment). Conclusions Children with AEL have unique clinical and biological characteristics, exhibit poor treatment response, and have a poor prognosis; however, hematopoietic stem cell transplantation may improve overall survival rates.

Objective To investigate the status of neurodevelopmental catch-up and suitable correction termination age in preterm infants of different gestational ages. Methods A total of 918 preterm infants without significant high-risk factors who attended the outpatient service of the Second Affiliated Hospital of Army Medical University from January 1, 2018 to March 1, 2023 were included. The data on developmental quotient (DQ) in Gesell Developmental Schedule (GDS) were collected, while 6 684 full-term infants were included as controls. According to the gestational age, the infants were divided into preterm groups (early preterm, moderate preterm, and late preterm births) and a full-term group, and these groups were compared in terms of DQ of each functional area and its changing trend with 48 months of chronological age. Results The DQ values of all functional areas showed a catch-up trend from 6 months to 48 months of chronological age in each preterm group (P<0.05). There were no significant differences in the DQ values of all functional areas between the late preterm and full-term groups at the chronological age of 36 months (P>0.05). There were significant differences in the DQ values of most functional areas between the moderately/early preterm groups and the full-term group at the chronological age of 36 months (P<0.05), but no significant differences were found in the DQ values of all functions areas at the chronological age of 48 months (P>0.05). Conclusions The correction termination age for neurodevelopment in preterm infants may need to extend beyond 36 months, and the smaller the gestational age, the longer the time required for correction.

Neonates are susceptible to respiratory viral infections, with outbreaks reported in areas with a high population of neonates, such as postpartum care centers and neonatal wards. While specific antiviral drugs are currently available for influenza, symptomatic supportive treatment remains the primary approach for respiratory syncytial virus (RSV), making prevention particularly important. The article closely follows the "Expert recommendations for the prevention of common respiratory viral infections in neonates" and provides an in-depth interpretation of recent breakthroughs in RSV prevention. It discusses the physiological and immunological characteristics of neonates, the disease burden and transmission routes of RSV infection, the main clinical manifestations and long-term effects of RSV infection in neonates, as well as specific preventive measures against RSV and practical recommendations and prevention experiences for RSV from abroad to lay a foundation for RSV prevention and control in neonates in China.

Objective To investigate the risk factors for the occurrence of bronchiolitis obliterans (BO) in children with refractory Mycoplasma pneumoniae pneumonia (RMPP) and their predictive value of the factors. Methods A retrospective analysis was performed for the medical records of 156 children with RMPP who were admitted to the hospital from May 2020 to March 2024. According to the diagnostic criteria for BO, they were divided into a BO group (n=76) and a non-BO group (n=80). A logistic regression analysis was used to investigate risk factors for the occurrence of BO, and the receiver operating characteristic (ROC) curve was used to assess the value of the model established based on the risk factors in predicting BO. Results Compared with the non-BO group, the BO group had a significantly longer duration of fever, a significantly higher leukocyte count, and a significantly lower albumin level (P<0.05). Compared with the non-BO group, the BO group had a significantly lower proportion of children with initiation of macrolide antibiotic therapy within 5 days, initiation of glucocorticoid therapy within 2 weeks, or initiation of bronchoscopic therapy within <2 weeks (P<0.05). The ROC curve analysis showed that the logistic regression model established based on the above six indicators had an area under the curve of 0.901 (95%CI: 0.849-0.953, P<0.001) in predicting the occurrence of BO, with a sensitivity of 0.893 and a specificity of 0.827 at the optimal cut-off value of 0.341. Conclusions The logistic regression model established based on duration of fever, leukocyte count, albumin, initiation of macrolide antibiotic therapy within 5 days, initiation of glucocorticoid therapy within 2 weeks, and initiation of bronchoscopic therapy within 2 weeks has relatively high sensitivity and specificity in predicting the occurrence of BO in children with RMPP.

Objective To construct a Z-score regression model for coronary artery diameter based on echocardiographic data from children in Sichuan Province and to establish a Z-score calculation formula. Methods A total of 744 healthy children who underwent physical examinations at Sichuan Provincial People's Hospital from January 2020 to December 2022 were selected as the modeling group, while 251 children diagnosed with Kawasaki disease at the same hospital from January 2018 to December 2022 were selected as the validation group. Pearson correlation analysis was conducted to analyze the relationships between coronary artery diameter values and age, height, weight, and body surface area. A regression model was constructed using function transformation to identify the optimal regression model and establish the Z-score calculation formula, which was then validated. Results The Pearson correlation analysis showed that the correlation coefficients for the diameters of the left main coronary artery, left anterior descending artery, left circumflex artery, and right coronary artery with body surface area were 0.815, 0.793, 0.704, and 0.802, respectively (P<0.05). Among the constructed regression models, the power function regression model demonstrated the best performance and was therefore chosen as the optimal model for establishing the Z-score calculation formula. Based on this Z-score calculation formula, the detection rate of coronary artery lesions was found to be 21.5% (54/251), which was higher than the detection rate based on absolute values of coronary artery diameter. Notably, in the left anterior descending and left circumflex arteries, the detection rate of coronary artery lesions using this Z-score calculation formula was higher than that of previous classic Z-score calculation formulas. Conclusions The Z-score calculation formula established based on the power function regression model has a higher detection rate for coronary artery lesions, providing a strong reference for clinicians, particularly in assessing coronary artery lesions in children with Kawasaki disease.

Objective To explore the measures to improve the follow-up rate of preterm infants after discharge, and to evaluate the effectiveness of these measures using quality improvement methodology. Methods The follow-up status of preterm infants discharged from March to May 2017 was used as the baseline before quality improvement, and a specific quality improvement goal for the follow-up rate was proposed. The Pareto chart was used to analyze the causes of follow-up failure, and a key driver diagram was constructed based on the links involved in improving follow-up rate. The causes of failure were analyzed to determine the key links and intervention measures for quality improvement, and the follow-up rate was monitored weekly using a control chart until the quality improvement goal was achieved. Results The follow-up rate of preterm infants after discharge was 57.92% (117/202) at baseline before quality improvement, and the quality improvement goal was set to increase the follow-up rate of preterm infants from baseline to more than 80% within 12 months. The Pareto chart analysis showed that the main causes of follow-up failure were deficiencies in follow-up file management and irregular follow-up times (33.70%, 31/92), insufficient follow-up education and poor communication (25.00%, 23/92), and the inability to meet the diverse needs of parents (18.48%, 17/92). Based on the key links for quality improvement and the main causes of follow-up failure, the following intervention measures were adopted: (1) strengthen follow-up publicity and education; (2) build a follow-up team; and (3) establish a follow-up platform and system. The control chart indicated that with the implementation of the above intervention measures, the weekly follow-up rate increased to 74.09% (306/413) in July 2017 and 83.09% (511/615) in December 2017, finally achieving the quality improvement goal. During the COVID-19 pandemic, the follow-up rate of preterm infants fluctuated between 23.54% (460/1 954) and 70.97% (1 931/2 721), and subsequently, it returned to pre-pandemic levels starting in February 2023. Conclusions The application of quality improvement methodology can help to formulate intervention measures based on the main causes of follow-up failure, thereby improving the follow-up rate of preterm infants after discharge. This quality improvement method is feasible and practical and thus holds promise for clinical application.

Objective To investigate the expression of soluble factor-related apoptosis ligand (sFasL) in peripheral blood and microRNA-147b (miR-147b) in monocytes in children with sepsis and their value in assessing prognosis. Methods A prospective study was conducted on 124 children with sepsis (sepsis group), 60 children with common infections (infection group), and 60 healthy children undergoing physical examinations (healthy control group). The independent risk factors for poor prognosis in children with sepsis were analyzed, and the value of serum sFasL and monocyte miR-147b in predicting poor prognosis in children with sepsis was assessed. Results The serum level of sFasL and the relative expression of miR-147b in monocytes were highest in the sepsis group, followed by the infection group and the healthy control group (P<0.05). The multivariate logistic regression analysis showed that the serum level of sFasL and the relative expression of miR-147b in monocytes were closely associated with the poor prognosis of children with sepsis (P<0.05). The receiver operating characteristic curve analysis showed that the combination of serum sFasL level and relative expression of miR-147b in monocytes had a larger area under the curve compared to each indicator alone in predicting the prognosis of children with sepsis (P<0.05). Conclusions There are significant increases in the level of sFasL in peripheral blood and the relative expression of miR-147b in monocytes in children with sepsis. The combined use of these two indicators has relatively high clinical value in assessing the prognosis of children with sepsis.

To guide clinical blood transfusion practices for pediatric patients, the National Health Commission has issued the health standard "Guideline for pediatric transfusion" (WS/T 795-2022). Blood transfusion for children undergoing hematopoietic stem cell transplantation is highly complex and challenging. This guideline provides recommendations on transfusion thresholds and the selection of blood components for these children. This article presents the evidence and interpretation of the transfusion provisions for children undergoing hematopoietic stem cell transplantation, with the aim of enhancing the understanding and implementation of the "Guideline for pediatric transfusion".

Objective To investigate the clinical features and gene mutation characteristics of combined oxidative phosphorylation deficiency type 7 (COXPD7) caused by mutations in the C12orf65 gene, and to enhance the awareness of this disease. Methods A child diagnosed with COXPD7 in the Department of Neurology, Children's Hospital Affiliated to Zhengzhou University in 2021 was included, along with 10 patients reported in the literature. All subjects were analyzed for their genotypes and clinical phenotypes. Results A total of 11 patients with COXPD7 were included, comprising 1 reported in this study and 10 from the literature. Among the 11 patients, 9 had homozygous mutations in the C12orf65 gene, while 2 had compound heterozygous mutations, which were identified as frameshift or nonsense mutations. The age of onset ranged from 1 day to 2 years, and clinical manifestations included optic nerve atrophy and delays in intellectual and motor development. Eight patients exhibited external ophthalmoplegia, and five patients displayed spastic paralysis. Cranial magnetic resonance imaging revealed optic nerve atrophy in all 11 patients, abnormal brainstem signals in 10 patients, and a lactate peak on brainstem magnetic resonance spectroscopy scans in 3 patients. Conclusions COXPD7 associated with the C12orf65 gene results from homozygous or compound heterozygous mutations, with primary clinical manifestations of optic nerve atrophy and delays in intellectual and motor development. Some patients may also present with spastic paralysis or external ophthalmoplegia. Cranial imaging reveals symmetrical abnormal signals in bilateral basal ganglia and brainstem, and a lactate peak is observed on brainstem magnetic resonance spectroscopy scans.

Objective To investigate the risk factors for plastic bronchitis (PB) in children with macrolide-unresponsive Mycoplasma pneumoniae pneumonia (MUMPP) and to establish a nomogram prediction model. Methods A retrospective analysis was conducted on 178 children with MUMPP who underwent bronchoscopy from January to December 2023. According to the presence or absence of PB, the children were divided into a PB group (49 children) and a non-PB group (129 children). The predictive factors for the development of PB in children with MUMPP were analyzed, and a nomogram prediction model was established. The model was assessed in terms of discriminatory ability, accuracy, and clinical effectiveness. Results The multivariate logistic regression analysis showed that older age and higher levels of lactate dehydrogenase and fibrinogen were closely associated with the development of PB in children with MUMPP (P<0.05). A nomogram model established based on these factors had an area under the receiver operating characteristic curve of 0.733 (95%CI: 0.651-0.816, P<0.001) and showed a good discriminatory ability. The Hosmer-Lemeshow goodness-of-fit test indicated that the predictive model had a good degree of fit (P>0.05), and the decision curve analysis showed that the model had a good clinical application value. Conclusions The risk nomogram model established based on age and lactate dehydrogenase and fibrinogen levels has good discriminatory ability, accuracy, and predictive efficacy for predicting the development of PB in children with MUMPP.

Objective To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. Methods A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. Results All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. Conclusions This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.

Objective To investigate the clinical characteristics and prognosis of infants and young children with basal ganglia infarction after minor head trauma (BGIMHT). Methods A retrospective analysis was conducted on the clinical data and follow-up results of children aged 28 days to 3 years with BGIMHT who were hospitalized at Children's Hospital of Soochow University from January 2011 to January 2022. Results A total of 45 cases of BGIMHT were included, with the most common symptom being limb movement disorders (96%, 43/45), followed by facioplegia (56%, 25/45). Cerebral imaging showed that 72% (31/43) had infarction accompanied by basal ganglia calcification. After conservative treatment, 42 children (93%) showed significant symptom improvement, while 3 children (7%) experienced recurrent strokes. The median follow-up time was 82 months (range: 17-141 months). At the last follow-up, 97% (29/30) had residual basal ganglia softening lesions. Among 29 cases participating in questionnaire follow-up, 66% (19/29) recovered normally, 17% (5/29) showed significant improvement in symptoms, and 17% (5/29) had poor improvement. According to the grading of the Global Burden of Disease Control Projects, only 1 child (3%) had severe sequelae. There were no significant differences in age at onset, gender, or presence of concomitant basal ganglia calcification between children with and without neurological sequelae (P>0.05). Conclusions The most common initial symptom of BGIMHT is limb movement disorder, and imaging results indicate that most children have concurrent intracranial calcifications. Most infarct lesions later transform into softening lesions, resulting in a generally good prognosis.

Objective To explore the predictive factors for non-response to intravenous immunoglobulin (IVIG) in children with Kawasaki disease (KD) and to establish an IVIG non-response prediction scoring model for the Sichuan region. Methods A retrospective study was conducted by collecting clinical data from children with KD admitted to four tertiary hospitals in Sichuan Province between 2019 and 2023. Among them, 940 children responded to IVIG, while 74 children did not respond. Multivariate logistic regression analysis was used to identify the predictive factors for non-response to IVIG and to establish a predictive scoring model. The model's effectiveness was assessed using the receiver operating characteristic curve (ROC) and validated with an independent dataset. Results Multivariate logistic regression analysis showed that the platelet-to-lymphocyte ratio (PLR), hemoglobin (Hb), serum creatinine, aspartate aminotransferase (AST), and platelet count (PLT) were closely related to non-response to IVIG in children with KD (P<0.05). Based on these indicators, a predictive scoring model was established: PLR > 199, 0.4 points; Hb ≤ 116 g/L, 4 points; AST > 58 U/L, 0.2 points; serum creatinine > 38 μmol/L, 3.9 points; PLT count ≤ 275 × 10⁹/L, 0.3 points. Using this model, children with KD were scored, and a total score greater than 4.3 was considered high risk of non-response to IVIG. The sensitivity of the model in predicting non-response to IVIG was 77.0%, specificity was 65.7%, and the area under the ROC curve was 0.746 (95%CI: 0.688-0.805). Conclusions The predictive scoring model based on PLR, Hb, serum creatinine, AST, and PLT demonstrates good predictive performance for non-response to IVIG in children with KD in the Sichuan region and can serve as a reference for clinical decision-making.

Objective To investigate the clinical sub-phenotype (SP) of pediatric acute kidney injury (AKI) and their association with clinical outcomes. Methods General status and initial values of laboratory markers within 24 hours after admission to the pediatric intensive care unit (PICU) were recorded for children with AKI in the derivation cohort (n=650) and the validation cohort (n=177). In the derivation cohort, a least absolute shrinkage and selection operator (LASSO) regression analysis was used to identify death-related indicators, and a two-step cluster analysis was employed to obtain the clinical SP of AKI. A logistic regression analysis was used to develop a parsimonious classifier model with simplified metrics, and the area under the curve (AUC) was used to assess the value of this model. This model was then applied to the validation cohort and the combined derivation and validation cohort. The association between SPs and clinical outcomes was analyzed with all children with AKI as subjects. Results In the derivation cohort, two clinical SPs of AKI (SP1 and SP2) were identified by the two-step cluster analysis using the 20 variables screened by LASSO regression, namely SP_d1 group (n=536) and SP_d2 group (n=114). The simplified classifier model containing eight variables (P<0.05) had an AUC of 0.965 in identifying the two clinical SPs of AKI (P<0.001). The validation cohort was clustered into SP_v1 group (n=156) and SP_v2 group (n=21), and the combined derivation and validation cohort was clustered into SP1 group (n=694) and SP2 group (n=133). After adjustment for confounding factors, compared with the SP1 group, the SP2 group had significantly higher incidence rates of multiple organ dysfunction syndrome and death during the PICU stay (P<0.001), and SP2 was significantly associated with the risk of death within 28 days after admission to the PICU (P<0.001). Conclusions This study establishes a parsimonious classifier model and identifies two clinical SPs of AKI with different clinical features and outcomes.The SP2 group has more severe disease and worse clinical prognosis.