Most Accessed

  • Published in last 1 year
  • In last 2 years
  • In last 3 years
  • All

Please wait a minute...
  • Select all
    |
  • STANDARD·PROTOCOL·GUIDELINE
    Neonatal Clinical Practice Guidelines Expert Committee of the Cross-Strait Medical and Health Exchange Association; Neonatal Evidence-Based Medicine Group of the Commission of Neonatal Medicine of the Cross-Strait Medical and Health Exchange Association; Editorial Office of the C
    Anemia of prematurity (AOP) is a multifactorial condition associated with congenital iron deficiency, low erythropoietin levels, a short lifespan of red blood cells, and iatrogenic blood loss. AOP is a common complication in premature infants that can adversely affect growth, development, and long-term neurocognitive outcomes. To standardize the diagnosis and treatment of AOP, the Neonatal Clinical Practice Guidelines Expert Committee and the Neonatal Evidence-Based Medicine Group of the Commission of Neonatal Medicine of the Cross-Strait Medical and Health Exchange Association, along with the Editorial Office of the Chinese Journal of Contemporary Pediatrics, have developed the "Clinical practice guidelines for the diagnosis and treatment of anemia of prematurity (2025)", based on the World Health Organization's handbook for guideline development and the formulation/revision principles of Chinese clinical practice guidelines. This guideline addresses eight clinical issues related to AOP, including risk factors, early identification, etiological diagnosis, diagnostic criteria, early prevention, transfusion therapy, strategies to improve prognosis, and post-discharge follow-up. It presents 29 recommendations formed from current evidence and expert consensus, aiming to provide guidance and decision-making support for healthcare professionals in the diagnosis and treatment of AOP.
  • STANDARD·PROTOCOL·GUIDELINE
    Nutritional Committee of Neonatology Branch of Chinese Medical Doctor Association; Preterm Committee of Neonatology Branch of Chinese Medical Doctor Association; Editorial Committee of Chinese Journal of Contemporary Pediatrics
    Parenteral nutrition (PN) is widely utilized in the field of neonatology and is a critical life-saving intervention for critically ill neonates or preterm infants who cannot meet their energy and nutrient needs through enteral feeding. To further standardize and optimize the clinical management of PN, this consensus was developed by a working group based on relevant research progress both domestically and internationally. Employing the Grading of Recommendations Assessment, Development and Evaluation, the consensus presents 24 recommendations covering seven aspects of PN: indications, administration routes, energy, fluid volume, composition of nutritional solutions, timing of cessation, and monitoring. The aim is to provide guidance for relevant practitioners in PN management to improve the short-term and long-term outcomes for neonates.
  • GUIDELINE INTERPRETATION: GUIDELINE FOR PEDIATRIC TRANSFUSION
    ZHAO Ming-Yi, HUANG Rong, GUI Rong, HE Qing-Nan, HEI Ming-Yan, ZHU Xiao-Fan, LU Jun, XU Xiao-Jun, YUAN Tian-Ming, ZHANG Rong, WANG Xu, LIU Jin-Ping, WANG Jing, SHAO Zhi-Li, GUO Yong-Jian, WU Xin-Yin, CHEN Jia-Rui, CHEN Qi-Rong, GUO Jia, YANG Ming-Hua
    To guide clinical blood transfusion practices for pediatric patients, the National Health Commission has issued the health standard "Guideline for pediatric transfusion" (WS/T 795-2022). Blood transfusion is one of the most commonly used supportive treatments for children with hematological diseases. This guideline provides guidance and recommendations for blood transfusions in children with aplastic anemia, thalassemia, autoimmune hemolytic anemia, glucose-6-phosphate dehydrogenase deficiency, acute leukemia, myelodysplastic syndromes, immune thrombocytopenic purpura, and thrombotic thrombocytopenic purpura. This article presents the evidence and interpretation of the blood transfusion provisions for children with hematological diseases in the "Guideline for pediatric transfusion", aiming to assist in the understanding and implementing the blood transfusion section of this guideline.
  • SERIES REVIEW—DIAGNOSIS AND TREATMENT OF GROWTH DISORDERS
    ZHOU Jian-Hua
    Growth disorders are one of the common complications of chronic kidney disease (CKD) in children, adversely affecting both the quality of life and survival time of CKD patients. Recombinant human growth hormone (rhGH) is an effective treatment for growth disorders in children with CKD. This article reviews the mechanisms underlying growth disorders in children with CKD, the therapeutic effects, safety, and precautions of rhGH, and long-term management of diagnosis and treatment of this disorder.
  • GUIDELINE INTERPRETATION
    PAN Yan, XIE Li-Jian, JIAO Fu-Yong
    This paper comprehensively compares the Kawasaki disease (KD) guidelines from seven countries/regions, including China, Argentina, Europe, Italy, Japan, Spain, and the United States, as retrieved from the PubMed database. It analyzes the similarities and differences in KD diagnosis and treatment among these guidelines. The results show that all guidelines consistently recommend a single infusion of immunoglobulin at a dosage of 2 g/kg as the first-line treatment for KD, and none advocate for the routine use of methylprednisolone or prednisone as standalone first-line treatment options for KD. However, there are some differences among the guidelines regarding classification, diagnostic criteria, and specific treatment methods for KD. Therefore, it is essential to further strengthen international collaboration in guideline development and conduct multicenter clinical research in the future, aiming to achieve a higher level of expert consensus, thereby promoting the enhancement of KD diagnosis and treatment.
  • CLINICAL RESEARCH
    YANG Yang, ZHAO Ming-Yi
    Objective To investigate the epidemiological characteristics and changing trends of communicable diseases among children and adolescents in China from 1990 to 2021. Methods Based on the Global Burden of Disease Database, epidemiological indicators for communicable diseases among the population aged under 20 years in China from 1990 to 2021 were selected to analyze the burden of communicable diseases in this population, and a comparative analysis was performed with global data as well as data from Western Europe and North America. Results In 1990-2021, the overall burden of communicable diseases tended to decrease among children and adolescents in China. In 2021, the prevalence rate of communicable diseases in China was lower than the global prevalence rate and was higher than that in Western Europe and North America. There was a significant reduction in the mortality rate of communicable diseases, and the gap with Western Europe and North America gradually narrowed year by year. The overall incidence rate, mortality rate, and disability-adjusted life year rate of communicable diseases in males were higher than those in females, and respiratory infections and intestinal infections were more common in children aged <5 years, while the incidence rate of sexually transmitted diseases was higher in adolescents. Conclusions From 1990 to 2021, the disease burden of communicable diseases among the population under 20 years old in China has significantly decreased. However, there is still a certain gap compared to developed regions. Strengthening the prevention and control of diseases such as respiratory infections and acquired immunodeficiency syndrome, as well as enhancing health interventions for children under 5 years old, will help improve the overall health level of children and adolescents in China.
  • SERIES REVIEW—DIAGNOSIS AND TREATMENT OF GROWTH DISORDERS
    LI Xin, WEN Tian, FENG Bi-Yun, WANG Xiu-Min
    Patients with Noonan syndrome (NS) are born with normal or slightly lower body length and weight compared to the normal ranges. However, their height gradually falls behind that of the general population, leading to growth retardation and delayed puberty. In China, the incidence of short stature in patients with NS is approximately 65%. Short stature in these patients arises from multiple causes, including feeding difficulties in infancy, comorbidities such as congenital heart disease, genetic heterogeneity, and disorders of the growth hormone/insulin-like growth factor-1 axis. Growth hormone is commonly used to alleviate symptoms of short stature. This article reviews the growth and development patterns at different stages of NS, analyzes the causes of short stature, and summarizes the latest advances in treatment to provide new insights for the diagnosis and management of short stature in patients with NS.
  • REVIEW
    XU Yu-Ting, HU Qun
    Thrombocytosis is a common condition in children, classified into primary and secondary types. Secondary thrombocytosis is mainly caused by factors such as infection, anemia, iron deficiency, trauma, or surgical intervention, and it typically occurs without severe thrombosis or bleeding events. Platelet counts can return to normal after control of the primary factors, with favorable clinical outcomes. Primary thrombocytosis is mainly caused by myeloproliferative neoplasms such as polycythemia vera, essential thrombocythemia, and myelofibrosis, often accompanied by gene mutations in hematopoietic cells. In children, clinical manifestations are atypical compared to adults, with few thromboembolic or bleeding events. No special treatment is required for patients who are asymptomatic or have mild symptoms, and it is recommended to regularly monitor platelet counts. Antiplatelet therapy with aspirin can be considered for patients at risk of thrombosis or those with extreme thrombocytosis, and cytoreductive therapy can be performed when necessary, but the toxicities and side effects of drugs should be closely monitored. At present, hydroxyurea, interferon-alpha, and anagrelide are commonly used for cytoreductive therapy. This article provides an overview of the etiology, classification, clinical manifestations, diagnosis, and treatment of childhood thrombocytosis to guide healthcare professionals in treatment decisions.
  • CLINICAL RESEARCH
    QIN Yu-Jie, YANG Yu-Xia, LI Jun-Xiang, GUAN Jun
    Objective To study the risk factors for hypoxemia in children with severe Mycoplasma pneumoniae pneumonia (SMPP). Methods A retrospective collection of clinical data from children diagnosed with SMPP at the Third Affiliated Hospital of Zhengzhou University from June to December 2023 was conducted. The patients were categorized into hypoxemia and non-hypoxemia groups. Logistic regression analysis was used to assess the risk factors for hypoxemia, and receiver operating characteristic (ROC) curve analysis was employed to analyze the diagnostic performance of various indicators. Results A total of 113 children with SMPP were included. Univariate logistic regression analysis showed that ferritin, aspartate aminotransferase, creatinine, creatine kinase isoenzyme, lactate dehydrogenase, alpha-hydroxybutyrate dehydrogenase, immunoglobulin G, complement C3, complement C4, age, extrapulmonary complications, and a chest computed tomography (CT) scan showing a bronchiolitis pattern were significant factors for hypoxemia in children with SMPP (P<0.05). Multivariate logistic regression analysis revealed that elevated ferritin levels, presence of extrapulmonary complications, and a bronchiolitis pattern on lung CT were independent risk factors for hypoxemia in these patients (P<0.05). The ROC curve analysis indicated that the combination of these three indicators for predicting hypoxemia had a sensitivity of 71.9%, a specificity of 95.1%, and an area under the curve of 0.888 (95%CI: 0.809-0.968). Conclusions In children with SMPP, when there are elevated ferritin levels, a bronchiolitis pattern on chest CT, and the presence of extrapulmonary complications, there should be a high level of vigilance for the potential development of hypoxemia.
  • CLINICAL RESEARCH
    YI Jia-Qin, SUN Dan
    Objective To investigate the efficacy and safety of perampanel (PER) add-on therapy in children with epilepsy of genetic etiology. Methods A retrospective analysis was conducted on the clinical data of 53 children who attended the Department of Neurology, Wuhan Children's Hospital, from November 2020 to April 2023. All children received PER add-on therapy and were diagnosed with epilepsy of genetic etiology based on whole-exome sequencing. The primary outcome measure was the proportion of children with a reduction in seizure frequency of ≥50% at month 12 of PER treatment (i.e., response rate), and the secondary outcome measures were response rates at months 3 and 6 of treatment. The influencing factors for the efficacy of PER add-on therapy in the treatment of epilepsy of genetic etiology were analyzed, and adverse events were recorded. Results The median follow-up duration was 13.10 months. After 12 months of follow-up, 42 children were included in the analysis, comprising 25 boys (60%) and 17 girls (40%). The median initial dose of PER was 1.5 (1.0, 2.0) mg/d, and the median maintenance dose was 4.0 (3.0, 8.0) mg/d. The response rates to PER at months 3, 6, and 12 of treatment were 61% (30/49), 54% (25/46), and 48% (20/42), respectively. No significant difference in the efficacy of PER was observed between children with mutations in genes encoding different protein functions (P>0.05). The most common adverse event reported was fatigue, observed in 3 children (6%). Conclusions PER add-on therapy demonstrates good efficacy and safety in children with epilepsy of genetic etiology. No influencing factors for the efficacy of PER have been identified to date.
  • CLINICAL RESEARCH
    ZHAO Xue-Qi, LU Wen-Li, LI Wen-Ying, WANG Jun-Qi, DONG Zhi-Ya, XIAO Yuan, ZHANG Xiao-Fei, JIANG Li, MA Xiao-Yu
    CSCD(1)
    Objective To explore the application of the colloidal gold method and chemiluminescence method in detecting gonadotropin (Gn) in morning urine for assessing pubertal development status in children. Methods A total of 132 children diagnosed with central precocious puberty (CPP), early and fast puberty (EFP), and premature thelarche (PT) at Ruijin Hospital Affiliated to Shanghai Jiao Tong University School of Medicine from November 2021 to December 2022 were included, along with 685 healthy children who underwent routine health examinations at the hospital's pediatric health care department during the same period. All 132 patients underwent a gonadotropin-releasing hormone (GnRH) stimulation test. Both patients and healthy children had their urinary Gn levels measured using the colloidal gold method and chemiluminescence method, including levels of luteinizing hormone (LH) and follicle-stimulating hormone (FSH). The correlation between serum Gn and urinary Gn detected by the two methods, as well as the correlation between Tanner stages of healthy children and urinary Gn, was analyzed. Results Urine Gn levels detected by both the colloidal gold method and chemiluminescence method showed a positive correlation with serum LH baseline values, LH peak values, baseline LH/FSH ratios, and peak LH/FSH ratios (P<0.05). In healthy children, urinary LH levels detected by the chemiluminescence method gradually increased from Tanner stage Ⅰ to Ⅳ (P<0.05), while urinary FSH levels were lower in Tanner stage I than in stages Ⅱ, Ⅲ, and IV (P<0.05). Urinary LH levels detected by the colloidal gold method were lower in Tanner stage I compared to stages Ⅱ, Ⅲ, and IV, with the highest levels observed in Tanner stage Ⅳ (P<0.05). Additionally, urinary FSH levels in Tanner stage Ⅲ were higher than in stages Ⅰ and Ⅱ (P<0.05). The area under the receiver operating characteristic curve for evaluating Tanner stages I and II in healthy children using urinary LH and FSH levels by the chemiluminescence method and urinary LH levels by the colloidal gold method were 0.730, 0.699, and 0.783, respectively. Conclusions The colloidal gold method and chemiluminescence method for detecting Gn in morning urine show good correlation with serum Gn levels. As a non-invasive and convenient detection method, the colloidal gold method can serve as a useful tool for screening the onset of pubertal development in children.
  • CLINICAL RESEARCH
    ZHAO Qian, WANG Yu, BIAN Lan-Zheng
    Objective To systematically review the methodological quality and measurement properties of childhood cancer-related fatigue assessment tools based on the consensus-based standards for the selection of health measurement instruments (COSMIN) guidelines, providing a basis for clinical practitioners to select appropriate assessment tools. Methods The databases searched included China National Knowledge Infrastructure, Wanfang Data, China Biomedical Literature, Weipu, PubMed, CINAHL, Embase, and Web of Science for studies published up to January 2024. Children under 12 years old and their primary caregivers were enrolled as subjects. Articles were screened based on inclusion criteria, and the key information regarding the assessment tools was extracted. The risk of bias checklist from the COSMIN guidelines and the quality standard rating scale were employed to evaluate measurement properties and formulate final recommendations. Results A total of 18 articles were included, covering 7 fatigue measurement tools, consisting of 4 specific tools and 3 generic tools tools. Methodological differences were observed in measurement properties across these scales. The Chinese Version of the Pediatric Patient-Reported Outcomes Measurement Information System (C-Ped-PROMIS) was rated as grade A recommendation due to its adequate content validity and internal consistency, while the remaining six scales were rated as grade B recommendation since their content validity was assessed as "insufficient" based on moderate-level evidence or higher. Conclusions The C-Ped-PROMIS scale demonstrates good reliability, validity, and cross-cultural validity as the preferred tool for measuring childhood cancer-related fatigue. The scale can serve as an auxiliary tool, and future research should focus on the applicability of various tools to enhance the effectiveness of interventions for assessing childhood cancer-related fatigue.
  • CLINICAL RESEARCH
    JI Pei-Hong, SUN Xuan, GAO Jin-Zhi, CHEN Ling
    Objective To investigate the value of weight growth velocity, calculated using the Patel exponential model and the Z-score change method, in predicting the neurological and physical development outcomes of preterm infants with a gestational age of <30 weeks in the long term. Methods A retrospective study was conducted involving preterm infants with a gestational age of <30 weeks who were hospitalized and treated in the Department of Neonatology at Tongji Hospital, Huazhong University of Science and Technology, from January 2017 to June 2022, and were followed up at the outpatient service more than 18 months of age. The preterm infants were divided into high and low rate groups based on the two calculation methods, and the two methods were compared regarding their predictive value for neurological and physical development outcomes in the long term. Results The average age of the last follow-up was (23.0±3.6) months. For neurological development, according to the Patel exponential model, the low rate group exhibited a significantly higher abnormal rate in the fine motor domain compared to the high rate group (P<0.05). Using the Z-score change method, the low rate group had significantly higher abnormal rates in both gross motor and fine motor domains, and significantly lower developmental quotients for gross motor, fine motor, and adaptive behavior domains compared to the high rate group (P<0.05). For physical development, there were no significant differences in body length, body weight, head circumference, or the incidence rate of growth restriction between the low rate and high rate groups identified by either method (P>0.05). Conclusions Weight growth velocity calculated using the Z-score change method is more effective in predicting long-term neurological outcomes in preterm infants, while weight growth velocity derived from both methods shows no significant association with long-term physical development outcomes.
  • CLINICAL RESEARCH
    LU Yan, WANG Li-Li, WANG Li, ZHU Ke-Ran
    Objective To evaluate the effect of colostrum oral immune therapy (COIT) on clinical outcomes in very low birth weight (VLBW) infants. Methods A computer-based search was conducted in databases including China National Knowledge Infrastructure, Wanfang Data, Weipu Database, Chinese Biomedical Literature Service System, PubMed, Embase, Web of Science, the Cochrane Library, and CINAHL for randomized controlled trials regarding the application of COIT in VLBW infants published from the establishment of the database to February 2024. Meta analysis was performed using RevMan 5.3 software. Results A total of 14 randomized controlled trials were included, involving 1 386 VLBW infants, with 690 in the COIT group and 696 in the control group. The results showed that COIT significantly reduced the incidence of clinical late-onset sepsis (LOS) (RR=0.75, 95%CI: 0.64-0.88, P<0.001), the incidence of blood culture-proven LOS (RR=0.72, 95%CI: 0.57-0.92, P=0.008), mortality rate (RR=0.70, 95%CI: 0.52-0.95, P=0.020), the incidence of necrotizing enterocolitis (RR=0.65, 95%CI: 0.46-0.92, P=0.020), and the incidence of feeding intolerance (RR=0.49, 95%CI: 0.29-0.80, P=0.004). It also shortened the time to achieve full enteral nutrition (MD=-2.13, 95%CI: -4.03 to -0.23, P=0.030). Conclusions COIT can reduce the incidence rates of LOS, necrotizing enterocolitis, and feeding intolerance, as well as the mortality rate, while also shortening the time to achieve full enteral nutrition in VLBW infants.
  • GUIDELINE INTERPRETATION
    CHENG Chen, WANG Ya-Juan, SHI Yuan
    Neonates are susceptible to respiratory viral infections, with outbreaks reported in areas with a high population of neonates, such as postpartum care centers and neonatal wards. While specific antiviral drugs are currently available for influenza, symptomatic supportive treatment remains the primary approach for respiratory syncytial virus (RSV), making prevention particularly important. The article closely follows the "Expert recommendations for the prevention of common respiratory viral infections in neonates" and provides an in-depth interpretation of recent breakthroughs in RSV prevention. It discusses the physiological and immunological characteristics of neonates, the disease burden and transmission routes of RSV infection, the main clinical manifestations and long-term effects of RSV infection in neonates, as well as specific preventive measures against RSV and practical recommendations and prevention experiences for RSV from abroad to lay a foundation for RSV prevention and control in neonates in China.
  • CLINICAL RESEARCH
    YU Pao, ZHANG Pei, GAO Chun-Lin, WANG Zi, ZHANG Yin, GE Zheng, ZHOU Bi
    Objective To study the significance of serum 25-hydroxyvitamin D3 [25-(OH)D3] level in the clinicopathological characteristics and prognosis of children with immunoglobulin A vasculitis nephritis (IgAVN). Methods A retrospective analysis was conducted on the clinical data of children with IgAVN who underwent renal biopsy at Suzhou Hospital Affiliated to Anhui Medical University and Jinling Hospital of the Medical School of Nanjing University from June 2015 to June 2020. Based on serum 25-(OH)D3 level, the patients were divided into a normal group and a lower group. The clinicopathological characteristics and follow-up data of the two groups were collected and compared. Results A total of 359 children with IgAVN were included. Compared to the normal group (62 cases), the lower group (297 cases) exhibited higher incidences of hematochezia and gross hematuria, higher levels of serum creatinine, blood urea nitrogen, urinary retinol protein, urinary N-acetyl-β-D-glucosaminidase, and quantitative urinary protein, and a longer duration from renal biopsy to urinary protein becoming negative, as well as lower estimated glomerular filtration rate and albumin level (P<0.05). Renal pathology in the lower group showed a higher occurrence of tubular interstitial injury, crescent formation, segmental sclerosis in glomeruli, and inflammatory cell infiltration in the renal interstitium compared to the normal group (P<0.05). Survival analysis indicated that the cumulative renal survival rate was lower in the lower group (P<0.05). Multivariate Cox regression analysis revealed that low serum 25-(OH)D3 level is an independent risk factor for poor prognosis in children with IgAVN. Conclusions Children with IgAVN and low serum 25-(OH)D3 level have relatively severe clinicopathological manifestations. Low serum 25-(OH)D3 level is an independent risk factor for poor prognosis in children with IgAVN.
  • CLINICAL RESEARCH
    ZHU Ping, QI Wen-Jing, TAO Ye-Qing, CUI Ding-Ding, SHENG Guang-Yao, WANG Chun-Mei
    Objective To investigate the clinical characteristics and prognosis of acute erythroleukemia (AEL) in children. Methods A retrospective analysis was conducted on the clinical data, treatment, and prognosis of 8 children with AEL treated at the First Affiliated Hospital of Zhengzhou University from January 2013 to December 2023. Results Among the 7 patients with complete bone marrow morphological analysis, 4 exhibited trilineage dysplasia, with a 100% incidence of erythroid dysplasia (7/7), a 71% incidence of myeloid dysplasia (5/7), and a 57% incidence of megakaryocytic dysplasia (4/7). Immunophenotyping revealed that myeloid antigens were primarily expressed as CD13, CD33, CD117, CD38, and CD123, with 4 cases expressing erythroid antigens CD71 and 2 cases expressing CD235a. Chromosomal analysis indicated that 2 cases presented with abnormal karyotypes, including +8 in one case and +4 accompanied by +6 in another; no complex karyotypes were observed. Genetic abnormalities were detected in 4 cases, with fusion genes including one case each of dup MLL positive and EVI1 positive, as well as mutations involving KRAS, NRAS, WT1, and UBTF. Seven patients received chemotherapy, with 6 achieving remission after one course of treatment; 2 underwent hematopoietic stem cell transplantation, and all had disease-free survival. Follow-up (median follow-up time of 6 months) showed that only 3 patients survived (2 cases after hematopoietic stem cell transplantation and 1 case during treatment). Conclusions Children with AEL have unique clinical and biological characteristics, exhibit poor treatment response, and have a poor prognosis; however, hematopoietic stem cell transplantation may improve overall survival rates.
  • STANDARD·PROTOCOL·GUIDELINE
    Committee of Thalassemia Prevention and Treatment, China Maternal and Child Health Association; Subspecialty Group of Hematology, Society of Pediatrics, Chinese Medical Association; China Thalassemia Prevention and Control Collaboration Network; Editorial Board of Chinese Journal
    Iron overload is a major complication of thalassemia, clinically manifested as heart failure, liver cirrhosis, diabetes, growth and development retardation, and delayed sexual development, with severe cases leading to death. Standardized iron chelation therapy is essential to ensure long-term and high-quality survival for patients. This guideline provides recommendations on methods for detecting iron overload, the timing for initiating iron chelation therapy, treatment strategies for transfusion-dependent and non-transfusion-dependent thalassemia, and special circumstances regarding iron chelation therapy, serving as a reference for iron chelation treatment in thalassemia.
  • CLINICAL RESEARCH
    WANG Yong, JIANG Jia-Ying, DENG Yan, LI Bo, SHUAI Ping, HU Xiao-Ping, ZHANG Yin-Yan, WU Han, YE Lu-Wei, PENG Qian
    Objective To construct a Z-score regression model for coronary artery diameter based on echocardiographic data from children in Sichuan Province and to establish a Z-score calculation formula. Methods A total of 744 healthy children who underwent physical examinations at Sichuan Provincial People's Hospital from January 2020 to December 2022 were selected as the modeling group, while 251 children diagnosed with Kawasaki disease at the same hospital from January 2018 to December 2022 were selected as the validation group. Pearson correlation analysis was conducted to analyze the relationships between coronary artery diameter values and age, height, weight, and body surface area. A regression model was constructed using function transformation to identify the optimal regression model and establish the Z-score calculation formula, which was then validated. Results The Pearson correlation analysis showed that the correlation coefficients for the diameters of the left main coronary artery, left anterior descending artery, left circumflex artery, and right coronary artery with body surface area were 0.815, 0.793, 0.704, and 0.802, respectively (P<0.05). Among the constructed regression models, the power function regression model demonstrated the best performance and was therefore chosen as the optimal model for establishing the Z-score calculation formula. Based on this Z-score calculation formula, the detection rate of coronary artery lesions was found to be 21.5% (54/251), which was higher than the detection rate based on absolute values of coronary artery diameter. Notably, in the left anterior descending and left circumflex arteries, the detection rate of coronary artery lesions using this Z-score calculation formula was higher than that of previous classic Z-score calculation formulas. Conclusions The Z-score calculation formula established based on the power function regression model has a higher detection rate for coronary artery lesions, providing a strong reference for clinicians, particularly in assessing coronary artery lesions in children with Kawasaki disease.
  • CLINICAL RESEARCH
    CHANG He-Sheng, YANG Xue, JU Jun, XU Wen-Ya, WU Di, WAN Xiao-Man, LI Zheng-Hong
    Objective To explore the measures to improve the follow-up rate of preterm infants after discharge, and to evaluate the effectiveness of these measures using quality improvement methodology. Methods The follow-up status of preterm infants discharged from March to May 2017 was used as the baseline before quality improvement, and a specific quality improvement goal for the follow-up rate was proposed. The Pareto chart was used to analyze the causes of follow-up failure, and a key driver diagram was constructed based on the links involved in improving follow-up rate. The causes of failure were analyzed to determine the key links and intervention measures for quality improvement, and the follow-up rate was monitored weekly using a control chart until the quality improvement goal was achieved. Results The follow-up rate of preterm infants after discharge was 57.92% (117/202) at baseline before quality improvement, and the quality improvement goal was set to increase the follow-up rate of preterm infants from baseline to more than 80% within 12 months. The Pareto chart analysis showed that the main causes of follow-up failure were deficiencies in follow-up file management and irregular follow-up times (33.70%, 31/92), insufficient follow-up education and poor communication (25.00%, 23/92), and the inability to meet the diverse needs of parents (18.48%, 17/92). Based on the key links for quality improvement and the main causes of follow-up failure, the following intervention measures were adopted: (1) strengthen follow-up publicity and education; (2) build a follow-up team; and (3) establish a follow-up platform and system. The control chart indicated that with the implementation of the above intervention measures, the weekly follow-up rate increased to 74.09% (306/413) in July 2017 and 83.09% (511/615) in December 2017, finally achieving the quality improvement goal. During the COVID-19 pandemic, the follow-up rate of preterm infants fluctuated between 23.54% (460/1 954) and 70.97% (1 931/2 721), and subsequently, it returned to pre-pandemic levels starting in February 2023. Conclusions The application of quality improvement methodology can help to formulate intervention measures based on the main causes of follow-up failure, thereby improving the follow-up rate of preterm infants after discharge. This quality improvement method is feasible and practical and thus holds promise for clinical application.
  • GUIDELINE INTERPRETATION
    HUANG Rong, HE Qing-Nan, HEI Ming-Yan, ZHU Xiao-Fan, LU Jun, XU Xiao-Jun, YUAN Tian-Ming, ZHANG Rong, WANG Xu, LIU Jin-Ping, WANG Jing, SHAO Zhi-Li, ZHAO Ming-Yi, GUO Yong-Jian, WU Xin-Yin, CHEN Jia-Rui, CHEN Qi-Rong, GUO Jia, GUI Rong, YANG Ming-Hua
    To guide clinical blood transfusion practices for pediatric patients, the National Health Commission has issued the health standard "Guideline for pediatric transfusion" (WS/T 795-2022). Blood transfusion for children undergoing hematopoietic stem cell transplantation is highly complex and challenging. This guideline provides recommendations on transfusion thresholds and the selection of blood components for these children. This article presents the evidence and interpretation of the transfusion provisions for children undergoing hematopoietic stem cell transplantation, with the aim of enhancing the understanding and implementation of the "Guideline for pediatric transfusion".
  • CLINICAL RESEARCH
    ZHANG Jun, LIN Xiao-Fei, WU Yun-Duo, ZHU Hong-Li, LIU Juan
    Objective To investigate the expression of soluble factor-related apoptosis ligand (sFasL) in peripheral blood and microRNA-147b (miR-147b) in monocytes in children with sepsis and their value in assessing prognosis. Methods A prospective study was conducted on 124 children with sepsis (sepsis group), 60 children with common infections (infection group), and 60 healthy children undergoing physical examinations (healthy control group). The independent risk factors for poor prognosis in children with sepsis were analyzed, and the value of serum sFasL and monocyte miR-147b in predicting poor prognosis in children with sepsis was assessed. Results The serum level of sFasL and the relative expression of miR-147b in monocytes were highest in the sepsis group, followed by the infection group and the healthy control group (P<0.05). The multivariate logistic regression analysis showed that the serum level of sFasL and the relative expression of miR-147b in monocytes were closely associated with the poor prognosis of children with sepsis (P<0.05). The receiver operating characteristic curve analysis showed that the combination of serum sFasL level and relative expression of miR-147b in monocytes had a larger area under the curve compared to each indicator alone in predicting the prognosis of children with sepsis (P<0.05). Conclusions There are significant increases in the level of sFasL in peripheral blood and the relative expression of miR-147b in monocytes in children with sepsis. The combined use of these two indicators has relatively high clinical value in assessing the prognosis of children with sepsis.
  • RARE DISEASE RESEARCH
    CHEN Xiao-Yi, ZHU Yong-Jie, DENG Jie, MA Yan-Li, SUO Jun-Fang, WANG Yuan, MA Yuan-Ning
    Objective To investigate the clinical features and gene mutation characteristics of combined oxidative phosphorylation deficiency type 7 (COXPD7) caused by mutations in the C12orf65 gene, and to enhance the awareness of this disease. Methods A child diagnosed with COXPD7 in the Department of Neurology, Children's Hospital Affiliated to Zhengzhou University in 2021 was included, along with 10 patients reported in the literature. All subjects were analyzed for their genotypes and clinical phenotypes. Results A total of 11 patients with COXPD7 were included, comprising 1 reported in this study and 10 from the literature. Among the 11 patients, 9 had homozygous mutations in the C12orf65 gene, while 2 had compound heterozygous mutations, which were identified as frameshift or nonsense mutations. The age of onset ranged from 1 day to 2 years, and clinical manifestations included optic nerve atrophy and delays in intellectual and motor development. Eight patients exhibited external ophthalmoplegia, and five patients displayed spastic paralysis. Cranial magnetic resonance imaging revealed optic nerve atrophy in all 11 patients, abnormal brainstem signals in 10 patients, and a lactate peak on brainstem magnetic resonance spectroscopy scans in 3 patients. Conclusions COXPD7 associated with the C12orf65 gene results from homozygous or compound heterozygous mutations, with primary clinical manifestations of optic nerve atrophy and delays in intellectual and motor development. Some patients may also present with spastic paralysis or external ophthalmoplegia. Cranial imaging reveals symmetrical abnormal signals in bilateral basal ganglia and brainstem, and a lactate peak is observed on brainstem magnetic resonance spectroscopy scans.
  • CLINICAL RESEARCH
    SHI Xiao-Song, HE Xiao-Hua, CHEN Jie
    Objective To investigate the risk factors for plastic bronchitis (PB) in children with macrolide-unresponsive Mycoplasma pneumoniae pneumonia (MUMPP) and to establish a nomogram prediction model. Methods A retrospective analysis was conducted on 178 children with MUMPP who underwent bronchoscopy from January to December 2023. According to the presence or absence of PB, the children were divided into a PB group (49 children) and a non-PB group (129 children). The predictive factors for the development of PB in children with MUMPP were analyzed, and a nomogram prediction model was established. The model was assessed in terms of discriminatory ability, accuracy, and clinical effectiveness. Results The multivariate logistic regression analysis showed that older age and higher levels of lactate dehydrogenase and fibrinogen were closely associated with the development of PB in children with MUMPP (P<0.05). A nomogram model established based on these factors had an area under the receiver operating characteristic curve of 0.733 (95%CI: 0.651-0.816, P<0.001) and showed a good discriminatory ability. The Hosmer-Lemeshow goodness-of-fit test indicated that the predictive model had a good degree of fit (P>0.05), and the decision curve analysis showed that the model had a good clinical application value. Conclusions The risk nomogram model established based on age and lactate dehydrogenase and fibrinogen levels has good discriminatory ability, accuracy, and predictive efficacy for predicting the development of PB in children with MUMPP.
  • CLINICAL RESEARCH
    YE Juan, YE Feng, HOU Ling, WU Wei, LUO Xiao-Ping, LIANG Yan
    Objective To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. Methods A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. Results All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. Conclusions This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
  • CLINICAL RESEARCH
    XU Huan, WU Chen-Chen, TANG Ji-Hong, FENG Jun, XIAO Xiao, SHI Xiao-Yan, MEI Dao-Qi
    Objective To investigate the clinical characteristics and prognosis of infants and young children with basal ganglia infarction after minor head trauma (BGIMHT). Methods A retrospective analysis was conducted on the clinical data and follow-up results of children aged 28 days to 3 years with BGIMHT who were hospitalized at Children's Hospital of Soochow University from January 2011 to January 2022. Results A total of 45 cases of BGIMHT were included, with the most common symptom being limb movement disorders (96%, 43/45), followed by facioplegia (56%, 25/45). Cerebral imaging showed that 72% (31/43) had infarction accompanied by basal ganglia calcification. After conservative treatment, 42 children (93%) showed significant symptom improvement, while 3 children (7%) experienced recurrent strokes. The median follow-up time was 82 months (range: 17-141 months). At the last follow-up, 97% (29/30) had residual basal ganglia softening lesions. Among 29 cases participating in questionnaire follow-up, 66% (19/29) recovered normally, 17% (5/29) showed significant improvement in symptoms, and 17% (5/29) had poor improvement. According to the grading of the Global Burden of Disease Control Projects, only 1 child (3%) had severe sequelae. There were no significant differences in age at onset, gender, or presence of concomitant basal ganglia calcification between children with and without neurological sequelae (P>0.05). Conclusions The most common initial symptom of BGIMHT is limb movement disorder, and imaging results indicate that most children have concurrent intracranial calcifications. Most infarct lesions later transform into softening lesions, resulting in a generally good prognosis.
  • CLINICAL RESEARCH
    HUANG Yi-Xu, HUANG Yu, PI Guang-Huan
    Objective To explore the predictive factors for non-response to intravenous immunoglobulin (IVIG) in children with Kawasaki disease (KD) and to establish an IVIG non-response prediction scoring model for the Sichuan region. Methods A retrospective study was conducted by collecting clinical data from children with KD admitted to four tertiary hospitals in Sichuan Province between 2019 and 2023. Among them, 940 children responded to IVIG, while 74 children did not respond. Multivariate logistic regression analysis was used to identify the predictive factors for non-response to IVIG and to establish a predictive scoring model. The model's effectiveness was assessed using the receiver operating characteristic curve (ROC) and validated with an independent dataset. Results Multivariate logistic regression analysis showed that the platelet-to-lymphocyte ratio (PLR), hemoglobin (Hb), serum creatinine, aspartate aminotransferase (AST), and platelet count (PLT) were closely related to non-response to IVIG in children with KD (P<0.05). Based on these indicators, a predictive scoring model was established: PLR > 199, 0.4 points; Hb ≤ 116 g/L, 4 points; AST > 58 U/L, 0.2 points; serum creatinine > 38 μmol/L, 3.9 points; PLT count ≤ 275 × 109/L, 0.3 points. Using this model, children with KD were scored, and a total score greater than 4.3 was considered high risk of non-response to IVIG. The sensitivity of the model in predicting non-response to IVIG was 77.0%, specificity was 65.7%, and the area under the ROC curve was 0.746 (95%CI: 0.688-0.805). Conclusions The predictive scoring model based on PLR, Hb, serum creatinine, AST, and PLT demonstrates good predictive performance for non-response to IVIG in children with KD in the Sichuan region and can serve as a reference for clinical decision-making.
  • REVIEW
    LI Jing-Yi, LI Yu-Jian, LAI Sheng-Lin, KAN Xuan
    Combined allergic rhinitis and asthma syndrome (CARAS) is one of the common chronic airway inflammatory diseases in children. With the development of epigenetics, research on CARAS has gradually extended from protein levels to molecular levels, such as transcription and post-transcriptional regulation. N6-methyladenosine (m6A) methylation and ferroptosis have emerged as promising research hotspots in recent years, playing crucial roles in tumors, growth and development, and allergic diseases. This paper aims to summarize the characteristics of m6A and ferroptosis, along with their roles in the onset and progression of CARAS in children, thereby providing new insights and strategies for the diagnosis and treatment of childhood CARAS.
  • CLINICAL RESEARCH
    FENG Lian, LI Min, JIANG Zhen, CHEN Jiao, BAI Zhen-Jiang, LI Xiao-Zhong, LU Guo-Ping, LI Yan-Hong
    Objective To investigate the clinical sub-phenotype (SP) of pediatric acute kidney injury (AKI) and their association with clinical outcomes. Methods General status and initial values of laboratory markers within 24 hours after admission to the pediatric intensive care unit (PICU) were recorded for children with AKI in the derivation cohort (n=650) and the validation cohort (n=177). In the derivation cohort, a least absolute shrinkage and selection operator (LASSO) regression analysis was used to identify death-related indicators, and a two-step cluster analysis was employed to obtain the clinical SP of AKI. A logistic regression analysis was used to develop a parsimonious classifier model with simplified metrics, and the area under the curve (AUC) was used to assess the value of this model. This model was then applied to the validation cohort and the combined derivation and validation cohort. The association between SPs and clinical outcomes was analyzed with all children with AKI as subjects. Results In the derivation cohort, two clinical SPs of AKI (SP1 and SP2) were identified by the two-step cluster analysis using the 20 variables screened by LASSO regression, namely SPd1 group (n=536) and SPd2 group (n=114). The simplified classifier model containing eight variables (P<0.05) had an AUC of 0.965 in identifying the two clinical SPs of AKI (P<0.001). The validation cohort was clustered into SPv1 group (n=156) and SPv2 group (n=21), and the combined derivation and validation cohort was clustered into SP1 group (n=694) and SP2 group (n=133). After adjustment for confounding factors, compared with the SP1 group, the SP2 group had significantly higher incidence rates of multiple organ dysfunction syndrome and death during the PICU stay (P<0.001), and SP2 was significantly associated with the risk of death within 28 days after admission to the PICU (P<0.001). Conclusions This study establishes a parsimonious classifier model and identifies two clinical SPs of AKI with different clinical features and outcomes.The SP2 group has more severe disease and worse clinical prognosis.
  • CLINICAL RESEARCH
    XIAO Yi, PAN Yu-Fan, DAI Yu, SUN Yu-Jian, ZHOU Yue, YU Yu-Feng
    Objective To systematically evaluate the prevalence and risk factors of non-alcoholic fatty liver disease (NAFLD) in overweight and obese children and adolescents in China. Methods Databases including China National Knowledge Infrastructure, Wanfang Data, VIP Database, China Biomedical Literature Database, PubMed, Embase, Web of Science, and Cochrane Library were searched, from database inception to October 2024. Two researchers independently screened the literature, extracted data, and assessed the quality of the studies according to inclusion and exclusion criteria. A Meta analysis was conducted using Stata 16.0 software. Results A total of 42 studies involving 16 481 overweight and obese children and adolescents were included. The Meta analysis results showed that the prevalence of NAFLD among overweight and obese children in China was 43% (95%CI: 37%-48%). Factors associated with NAFLD included being male (OR=1.61, 95%CI: 1.17-2.04), increased weight (MD=10.33, 95%CI: 9.08-11.57), increased waist circumference (MD=5.49, 95%CI: 3.36-7.62), longer duration of obesity (MD=0.31, 95%CI: 0.02-0.61), higher body mass index (MD=3.11, 95%CI: 2.07-4.16), elevated fasting blood glucose levels (MD=0.17, 95%CI: 0.06-0.29), higher triglyceride levels (MD=0.32, 95%CI: 0.17-0.47), elevated total cholesterol levels (MD=0.15, 95%CI: 0.10-0.21), higher low-density lipoprotein cholesterol levels (MD=0.14, 95%CI: 0.04-0.23), increased alanine aminotransferase levels (MD=24.39, 95%CI: 18.57-30.20), increased aspartate aminotransferase levels (MD=12.49, 95%CI: 9.67-15.32), elevated serum insulin levels (MD=4.47, 95%CI: 2.57-6.36), higher homeostasis model assessment-insulin resistance (MD=0.45, 95%CI: 0.30-0.59), and elevated uric acid levels (MD=55.91, 95%CI: 35.49-76.32) (P<0.05). Conclusions The prevalence of NAFLD among overweight and obese children and adolescents in China is high. Male gender, increased weight, increased waist circumference, prolonged obesity duration, higher body mass index, dyslipidemia, and elevated levels of fasting blood glucose, liver enzymes, serum insulin, homeostasis model assessment-insulin resistance, and uric acid are potential risk factors for NAFLD in this population.
  • REVIEW
    GENG Hui-Yun, WANG Zhi-Hua
    Maturity-onset diabetes of the young (MODY) is a special type of diabetes characterized by clinical features including early onset of diabetes (before 30 years of age), autosomal dominant inheritance, impaired glucose-induced insulin secretion, and hyperglycemia. So far, 14 types of MODY have been reported, accounting for about 1%-5% of the patients with diabetes. MODY often presents with an insidious onset, and although 14 subtypes have been identified for MODY, it is frequently misdiagnosed as type 1 or type 2 diabetes due to overlapping clinical features and high costs and limitations of genetic testing. This article reviews the clinical features of MODY subtypes in order to improve the accuracy of the diagnosis and treatment of MODY.
  • REVIEW
    ZHOU Ying-Zhen, WANG Ting, FU Xing-Meng, PENG Bing-Ming, FU Zhou
    Children with bronchopulmonary dysplasia (BPD) often exhibit severe respiratory problems and significant pulmonary dysfunction during school age and adulthood. Exercise tests show a decline in cardiopulmonary function and physical performance in children with BPD, who also have a higher incidence of pulmonary hypertension. These children generally perform poorly in terms of intelligence, language, and motor development. As they age, the risk of neurodevelopmental disorders increases, and health-related quality of life is also affected. This article reviews the prognosis of the respiratory system, physical capacity, cardiovascular system, nervous system, and health-related quality of life in children with BPD, aiming to improve the management of these patients and enhance their subsequent quality of life.
  • CLINICAL RESEARCH
    MU Jun, LI Shu-Shu, SU Ai-Ling, HAN Shu-Ping, ZHU Jin-Gai
    Objective To explore the predictive factors for hemodynamically significant patent ductus arteriosus (hsPDA) in preterm infants and to construct a nomogram prediction model for hsPDA occurrence in this population. Methods A retrospective analysis was conducted on the clinical data of preterm infants with gestational age <32 weeks diagnosed with patent ductus arteriosus (PDA) who were delivered at Nanjing Women and Children's Healthcare Hospital from January 2020 to December 2022. The subjects were divided into an hsPDA group (52 cases) and a non-hsPDA group (176 cases) based on the presence of hsPDA. Univariate analysis and multivariate logistic regression analysis were performed to screen predictive variables regarding the general information of the infants at birth, maternal pregnancy and delivery conditions, and relevant indicators during hospitalization. A nomogram prediction model for hsPDA occurrence was constructed using R software in preterm infants. Internal validation was performed using the Bootstrap method. Finally, the predictive model was evaluated for calibration, discrimination ability, and clinical utility. Results Multivariate regression analysis showed that the ratio of the left atrium to aorta diameter (LA/AO), mode of delivery (vaginal), and duration of mechanical ventilation were independent predictive factors for hsPDA in preterm infants (P<0.05). Based on the results of univariate analysis and multivariate logistic regression analysis, variables used to construct the nomogram prediction model for hsPDA risk included: LA/AO ratio, mode of delivery (vaginal), duration of mechanical ventilation, 5-minute Apgar score, and the presence of neonatal respiratory distress syndrome requiring surfactant therapy. The area under the receiver operating characteristic curve for this model was 0.876 (95%CI: 0.824-0.927), and the calibrated curve was close to the ideal reference line, indicating good calibration. The Hosmer-Lemeshow test demonstrated that the model fit well, and the clinical decision curve was above the extreme curves. Conclusions The nomogram prediction model, constructed using five variables (LA/AO ratio, vaginal delivery, duration of mechanical ventilation, 5-minute Apgar score, and the presence of neonatal respiratory distress syndrome requiring surfactant therapy), has reference significance for predicting the occurrence of hsPDA in preterm infants and provides valuable guidance for the early clinical identification of hsPDA.
  • SERIES REVIEW—DIAGNOSIS AND TREATMENT OF GROWTH DISORDERS
    LI Li, XIONG Feng
    Achondroplasia (ACH) is a common skeletal dysplasia in children, primarily caused by mutations in the fibroblast growth factor receptor 3 (FGFR3) gene. These mutations disrupt the process of endochondral ossification in different types of bones, including long bones of the limbs and vertebrae. Children with ACH typically present with short stature and may experience severe multi-system complications. The diagnosis of ACH is based on typical clinical manifestations, imaging features, and genetic testing results. Treatment options mainly include pharmacological interventions and surgical procedures aimed at improving height, as well as symptomatic management for associated complications. This article discusses both prenatal and clinical diagnostic approaches for ACH, as well as treatment strategies focused on enhancing height, aiming to deepen the understanding of this condition.
  • CLINICAL RESEARCH
    DUAN Hao-Lin, ZHANG Ci-Liu, YANG Li-Fen, HE Fang, MAO Lei-Lei, PENG Jing
    Objective To explore the efficacy and adverse reactions of nusinersen combined with risdiplam in the treatment of spinal muscular atrophy (SMA). Methods A retrospective analysis was conducted on the clinical data of 10 pediatric SMA patients treated with nusinersen combined with risdiplam at the Children's Medical Center of Xiangya Hospital, Central South University. Results Among the 10 SMA patients, there were 4 with type I, 4 with type II, and 2 with type III. Nine patients initially received nusinersen monotherapy, while 1 patient received nusinersen combined with risdiplam. The median duration of combination therapy with nusinersen and risdiplam for the 10 patients was 10.5 months (range: 0.5-20.0 months), with 6 patients undergoing combination therapy for more than 6 months, showing improvements in motor and/or respiratory function. The remaining 4 patients had combination treatment durations of 0.5, 1.0, 1.3, and 4.0 months, respectively, with no significant overall improvement. After combined treatment, 5 patients experienced skin hyperpigmentation, 2 had lumbar puncture site pain, 1 experienced vomiting, 1 had increased sputum production, and 1 had reduced total sleep time. All adverse reactions were mild and did not require medical intervention. Conclusions Nusinersen combined with risdiplam demonstrates efficacy in the treatment of SMA, and no significant adverse reactions have been observed.
  • CLINICAL RESEARCH
    LI Meng-Meng, LI Shu-Shu, QIAN Miao, ZHANG Min, HAN Shu-Ping
    Objective To explore the impact of different treatment attitudes on the survival status of extremely preterm infants (EPIs) and evaluate the mortality and occurrence of severe complications in actively treated infants, as well as their risk factors. Methods A retrospective analysis was conducted on perinatal data of EPIs born between January 1, 2016, and December 31, 2023, who were admitted to the neonatal intensive care unit of Nanjing Women and Children's Healthcare Hospital within 24 hours after birth. The analysis focused on the attributable risk of mortality associated with different treatment attitudes in EPIs of varying gestational ages and birth weights. A multivariate logistic regression model was used to analyze the risk factors for mortality and severe complications in the actively treated group. Results A total of 485 EPIs were included. As gestational age or birth weight increased, the attributable risk of mortality with care withdrawal increased. Active treatment significantly improved the survival status of EPIs born at a gestational age of ≥24 weeks. Multivariate logistic regression analysis indicated that lower gestational age and the need for mechanical ventilation within 72 hours after birth were independent risk factors for mortality or severe complications in EPIs (P<0.05). Conclusions Active treatment can significantly extend the survival time of EPIs born at a gestational age of ≥24 weeks. Lower gestational age and the need for mechanical ventilation within 72 hours after birth are closely associated with poor survival outcomes in EPIs.
  • REVIEW
    LEI Shi-Yi, LI Chen-Yang, LIU Ling-Juan, YUAN Yu-Xing, TIAN Jie
    Heart failure is a complex clinical syndrome and pediatric heart failure (PHF) has a high mortality rate. Early diagnosis is crucial for treatment and management of PHF. In clinical practice, various tests and examinations play a key role in the diagnosis of PHF, including continuously updated biomarkers, echocardiography, and cardiac magnetic resonance imaging. This article focuses on summarizing relevant research on biomarkers, examinations, combined testing, clinical models, and the grading and staging of PHF diagnosis, aiming to provide insights and directions for the diagnosis of PHF.
  • SERIES REVIEW—DIAGNOSIS AND TREATMENT OF GROWTH DISORDERS
    FAN Xin, HUANG Yi-Yun
    Transfusion-dependent thalassemia (TDT) is a severe genetic chronic hemolytic disease, and growth retardation is a common clinical feature in patients with TDT. Due to the need for regular blood transfusions, these patients often experience iron overload, which leads to various endocrine dysfunctions, including abnormalities in the growth hormone/insulin-like growth factor axis, hypothyroidism, hypoparathyroidism, hypogonadism, adrenal insufficiency, and decreased bone density. This paper reviews the clinical monitoring and intervention measures for growth disorders and related endocrine functions in patients with TDT, providing references for clinicians.
  • CLINICAL RESEARCH
    SHI Li-Xia, ZHAO Ming-Zhong, WANG Fei-Fei, XING Yu-Qian, JI Hong-Yan, ZHAO Ping
    Objective To assess the changes in body composition and nutritional risks faced by children with different stages of acute leukemia (AL). Methods Bioelectrical impedance analysis combined with anthropometric measurements was used to detect body composition. This prospective study was conducted from August 2023 to July 2024 at Shandong Provincial Hospital, examining the body composition and physical balance of children with various stages of AL and healthy children. Results The non-fat components of children with AL and healthy children both showed a linear increase with age. In the younger age group, there were no significant differences in body composition between children with AL and healthy children. However, in the older age group, the body composition of children undergoing chemotherapy for AL was significantly lower than that of healthy children (P<0.05), and muscle mass recovered first after the completion of AL chemotherapy. The proportion of children with increased trunk fat in AL children who completed chemotherapy was significantly lower than that in healthy children (P<0.05), while the incidence rate of severe left-right imbalance in body composition was significantly higher (P<0.05). Muscle distribution in children with AL primarily showed insufficient limb and overall muscle mass, whereas healthy children mainly exhibited insufficient upper limb muscle mass. Conclusions The body composition of children with AL varies at different treatment stages, indicating that nutritional status is affected by both the disease itself and the treatment. Early screening can provide a basis for reasonable nutritional intervention.
  • CLINICAL RESEARCH
    PENG Dong, WANG Ying, ZHOU Gui-Chi, LI Qian, LUO Mei-Zhu, LUO Li-Ping, KUANG Ya-Xian, FU Xiao-Ying
    Objective To investigate the application value of thromboelastography (TEG) in assessing coagulation function in children with severe hemophilia A (HA) after emicizumab (EMI) therapy. Methods A retrospective analysis was performed on the activated partial thromboplastin time (APTT) and TEG testing results of 17 children with severe HA before and after EMI treatment at Shenzhen Children's Hospital from January 2023 to July 2024. Correlation analysis was conducted between coagulation factor VIII (FVIII) equivalent activity and reaction time (R value) measured by TEG. Results After EMI treatment, the mean bleeding rate for children with severe HA was 1.6 events per year, with 15 children (88%) without spontaneous bleeding or joint bleeding. The children with severe HA showed a significant reduction in APTT after EMI treatment (P<0.05), with a significantly shorter APTT than the normal control group (P<0.05). There was no correlation between APTT and FVIII equivalent activity after treatment (P>0.05). After EMI treatment, TEG parameters, including R value, kinetic time, alpha angle (α), maximum amplitude, clot strength, and coagulation index, shifted from a hypocoagulable state before treatment to a nearly normal state after treatment (P<0.05). The R value demonstrated a strong negative correlation with FVIII equivalent activity (r=-0.758, P<0.05). Conclusions The bleeding condition of children with severe HA can be effectively controlled after EMI treatment. Routine APTT testing cannot reflect true coagulation function, whereas TEG testing is clinically valuable in assessing the coagulation function of children with severe HA undergoing EMI treatment.