CJCP
中文版
English Version
Home
Instructions to Authors
Journal Browse
About Journal
Columns
Manuscript Submission and Publishing
Requests for the Manuscript
Ethics
Informed Consent
Conflict of Interest
Peer-Review Policy and Process
Advertising Policy
Data Sharing Policy
Corrections and Retractions
Newest Journal
Archive
2025 Vol. 27 No. 1
Published: 2025-01-17
GUIDELINE INTERPRETATION
SERIES REVIEW—DIAGNOSIS AND TREATMENT OF GROWTH DISORDERS
GUIDELINE INTERPRETATION: GUIDELINE FOR PEDIATRIC TRANSFUSION
STANDARD·PROTOCOL·GUIDELINE
CLINICAL RESEARCH
EXPERIMENTAL RESEARCH
REVIEW
STANDARD·PROTOCOL·GUIDELINE
1
Neonatal Clinical Practice Guidelines Expert Committee of the Cross-Strait Medical and Health Exchange Association; Neonatal Evidence-Based Medicine Group of the Commission of Neonatal Medicine of the Cross-Strait Medical and Health Exchange Association; Editorial Office of the C
Clinical practice guidelines for the diagnosis and treatment of anemia of prematurity (2025)
Hot!
Anemia of prematurity (AOP) is a multifactorial condition associated with congenital iron deficiency, low erythropoietin levels, a short lifespan of red blood cells, and iatrogenic blood loss. AOP is a common complication in premature infants that can adversely affect growth, development, and long-term neurocognitive outcomes. To standardize the diagnosis and treatment of AOP, the Neonatal Clinical Practice Guidelines Expert Committee and the Neonatal Evidence-Based Medicine Group of the Commission of Neonatal Medicine of the Cross-Strait Medical and Health Exchange Association, along with the Editorial Office of the Chinese Journal of Contemporary Pediatrics, have developed the "Clinical practice guidelines for the diagnosis and treatment of anemia of prematurity (2025)", based on the World Health Organization's handbook for guideline development and the formulation/revision principles of Chinese clinical practice guidelines. This guideline addresses eight clinical issues related to AOP, including risk factors, early identification, etiological diagnosis, diagnostic criteria, early prevention, transfusion therapy, strategies to improve prognosis, and post-discharge follow-up. It presents 29 recommendations formed from current evidence and expert consensus, aiming to provide guidance and decision-making support for healthcare professionals in the diagnosis and treatment of AOP.
2025 Vol. 27 (1): 1-17 [
Abstract
] (
2836
) [
HTML
1KB] [
PDF
1372KB] (
2801
)
GUIDELINE INTERPRETATION: GUIDELINE FOR PEDIATRIC TRANSFUSION
18
ZHAO Ming-Yi, HUANG Rong, GUI Rong, HE Qing-Nan, HEI Ming-Yan, ZHU Xiao-Fan, LU Jun, XU Xiao-Jun, YUAN Tian-Ming, ZHANG Rong, WANG Xu, LIU Jin-Ping, WANG Jing, SHAO Zhi-Li, GUO Yong-Jian, WU Xin-Yin, CHEN Jia-Rui, CHEN Qi-Rong, GUO Jia, YANG Ming-Hua
')" href="#">
Explanation and interpretation of blood transfusion provisions for children with hematological diseases in the national health standard "Guideline for pediatric transfusion"
To guide clinical blood transfusion practices for pediatric patients, the National Health Commission has issued the health standard "Guideline for pediatric transfusion" (WS/T 795-2022). Blood transfusion is one of the most commonly used supportive treatments for children with hematological diseases. This guideline provides guidance and recommendations for blood transfusions in children with aplastic anemia, thalassemia, autoimmune hemolytic anemia, glucose-6-phosphate dehydrogenase deficiency, acute leukemia, myelodysplastic syndromes, immune thrombocytopenic purpura, and thrombotic thrombocytopenic purpura. This article presents the evidence and interpretation of the blood transfusion provisions for children with hematological diseases in the "Guideline for pediatric transfusion", aiming to assist in the understanding and implementing the blood transfusion section of this guideline.
2025 Vol. 27 (1): 18-25 [
Abstract
] (
1988
) [
HTML
1KB] [
PDF
592KB] (
1139
)
GUIDELINE INTERPRETATION
26
CHENG Chen, WANG Ya-Juan, SHI Yuan
')" href="#">
Interpretation of "Expert recommendations for the prevention of common respiratory viral infections in neonates": problems faced by respiratory syncytial virus infection in neonates
Neonates are susceptible to respiratory viral infections, with outbreaks reported in areas with a high population of neonates, such as postpartum care centers and neonatal wards. While specific antiviral drugs are currently available for influenza, symptomatic supportive treatment remains the primary approach for respiratory syncytial virus (RSV), making prevention particularly important. The article closely follows the "Expert recommendations for the prevention of common respiratory viral infections in neonates" and provides an in-depth interpretation of recent breakthroughs in RSV prevention. It discusses the physiological and immunological characteristics of neonates, the disease burden and transmission routes of RSV infection, the main clinical manifestations and long-term effects of RSV infection in neonates, as well as specific preventive measures against RSV and practical recommendations and prevention experiences for RSV from abroad to lay a foundation for RSV prevention and control in neonates in China.
2025 Vol. 27 (1): 26-32 [
Abstract
] (
1445
) [
HTML
1KB] [
PDF
594KB] (
854
)
SERIES REVIEW—DIAGNOSIS AND TREATMENT OF GROWTH DISORDERS
33
LI Xin, WEN Tian, FENG Bi-Yun, WANG Xiu-Min
Growth and development patterns of Noonan syndrome and advances in the treatment of short stature
Patients with Noonan syndrome (NS) are born with normal or slightly lower body length and weight compared to the normal ranges. However, their height gradually falls behind that of the general population, leading to growth retardation and delayed puberty. In China, the incidence of short stature in patients with NS is approximately 65%. Short stature in these patients arises from multiple causes, including feeding difficulties in infancy, comorbidities such as congenital heart disease, genetic heterogeneity, and disorders of the growth hormone/insulin-like growth factor-1 axis. Growth hormone is commonly used to alleviate symptoms of short stature. This article reviews the growth and development patterns at different stages of NS, analyzes the causes of short stature, and summarizes the latest advances in treatment to provide new insights for the diagnosis and management of short stature in patients with NS.
2025 Vol. 27 (1): 33-38 [
Abstract
] (
1657
) [
HTML
1KB] [
PDF
588KB] (
868
)
CLINICAL RESEARCH
39
YANG Yang, ZHAO Ming-Yi
Disease burden of communicable diseases among children and adolescents aged under 20 years in China from 1990 to 2021
Objective To investigate the epidemiological characteristics and changing trends of communicable diseases among children and adolescents in China from 1990 to 2021. Methods Based on the Global Burden of Disease Database, epidemiological indicators for communicable diseases among the population aged under 20 years in China from 1990 to 2021 were selected to analyze the burden of communicable diseases in this population, and a comparative analysis was performed with global data as well as data from Western Europe and North America. Results In 1990-2021, the overall burden of communicable diseases tended to decrease among children and adolescents in China. In 2021, the prevalence rate of communicable diseases in China was lower than the global prevalence rate and was higher than that in Western Europe and North America. There was a significant reduction in the mortality rate of communicable diseases, and the gap with Western Europe and North America gradually narrowed year by year. The overall incidence rate, mortality rate, and disability-adjusted life year rate of communicable diseases in males were higher than those in females, and respiratory infections and intestinal infections were more common in children aged <5 years, while the incidence rate of sexually transmitted diseases was higher in adolescents. Conclusions From 1990 to 2021, the disease burden of communicable diseases among the population under 20 years old in China has significantly decreased. However, there is still a certain gap compared to developed regions. Strengthening the prevention and control of diseases such as respiratory infections and acquired immunodeficiency syndrome, as well as enhancing health interventions for children under 5 years old, will help improve the overall health level of children and adolescents in China.
2025 Vol. 27 (1): 39-46 [
Abstract
] (
1724
) [
HTML
1KB] [
PDF
1106KB] (
756
)
47
FENG Lian, LI Min, JIANG Zhen, CHEN Jiao, BAI Zhen-Jiang, LI Xiao-Zhong, LU Guo-Ping, LI Yan-Hong
Clinical sub-phenotypes of acute kidney injury in children and their association with prognosis
Objective To investigate the clinical sub-phenotype (SP) of pediatric acute kidney injury (AKI) and their association with clinical outcomes. Methods General status and initial values of laboratory markers within 24 hours after admission to the pediatric intensive care unit (PICU) were recorded for children with AKI in the derivation cohort (
n
=650) and the validation cohort (
n
=177). In the derivation cohort, a least absolute shrinkage and selection operator (LASSO) regression analysis was used to identify death-related indicators, and a two-step cluster analysis was employed to obtain the clinical SP of AKI. A logistic regression analysis was used to develop a parsimonious classifier model with simplified metrics, and the area under the curve (AUC) was used to assess the value of this model. This model was then applied to the validation cohort and the combined derivation and validation cohort. The association between SPs and clinical outcomes was analyzed with all children with AKI as subjects. Results In the derivation cohort, two clinical SPs of AKI (SP1 and SP2) were identified by the two-step cluster analysis using the 20 variables screened by LASSO regression, namely SP
d
1 group (
n
=536) and SP
d
2 group (
n
=114). The simplified classifier model containing eight variables (
P
<0.05) had an AUC of 0.965 in identifying the two clinical SPs of AKI (
P
<0.001). The validation cohort was clustered into SP
v
1 group (
n
=156) and SP
v
2 group (
n
=21), and the combined derivation and validation cohort was clustered into SP1 group (
n
=694) and SP2 group (
n
=133). After adjustment for confounding factors, compared with the SP1 group, the SP2 group had significantly higher incidence rates of multiple organ dysfunction syndrome and death during the PICU stay (
P
<0.001), and SP2 was significantly associated with the risk of death within 28 days after admission to the PICU (
P
<0.001). Conclusions This study establishes a parsimonious classifier model and identifies two clinical SPs of AKI with different clinical features and outcomes.The SP2 group has more severe disease and worse clinical prognosis.
2025 Vol. 27 (1): 47-54 [
Abstract
] (
1275
) [
HTML
1KB] [
PDF
768KB] (
718
)
55
YU Pao, ZHANG Pei, GAO Chun-Lin, WANG Zi, ZHANG Yin, GE Zheng, ZHOU Bi
Clinicopathological significance and prognostic value of serum 25-hydroxyvitamin D
3
level in children with IgA vasculitis nephritis
Objective To study the significance of serum 25-hydroxyvitamin D
3
[25-(OH)D
3
] level in the clinicopathological characteristics and prognosis of children with immunoglobulin A vasculitis nephritis (IgAVN). Methods A retrospective analysis was conducted on the clinical data of children with IgAVN who underwent renal biopsy at Suzhou Hospital Affiliated to Anhui Medical University and Jinling Hospital of the Medical School of Nanjing University from June 2015 to June 2020. Based on serum 25-(OH)D
3
level, the patients were divided into a normal group and a lower group. The clinicopathological characteristics and follow-up data of the two groups were collected and compared. Results A total of 359 children with IgAVN were included. Compared to the normal group (62 cases), the lower group (297 cases) exhibited higher incidences of hematochezia and gross hematuria, higher levels of serum creatinine, blood urea nitrogen, urinary retinol protein, urinary N-acetyl-β-D-glucosaminidase, and quantitative urinary protein, and a longer duration from renal biopsy to urinary protein becoming negative, as well as lower estimated glomerular filtration rate and albumin level (
P
<0.05). Renal pathology in the lower group showed a higher occurrence of tubular interstitial injury, crescent formation, segmental sclerosis in glomeruli, and inflammatory cell infiltration in the renal interstitium compared to the normal group (
P
<0.05). Survival analysis indicated that the cumulative renal survival rate was lower in the lower group (
P
<0.05). Multivariate Cox regression analysis revealed that low serum 25-(OH)D
3
level is an independent risk factor for poor prognosis in children with IgAVN. Conclusions Children with IgAVN and low serum 25-(OH)D
3
level have relatively severe clinicopathological manifestations. Low serum 25-(OH)D
3
level is an independent risk factor for poor prognosis in children with IgAVN.
2025 Vol. 27 (1): 55-61 [
Abstract
] (
1568
) [
HTML
1KB] [
PDF
683KB] (
970
)
62
SHI Xiao-Song, HE Xiao-Hua, CHEN Jie
Risk factors for plastic bronchitis in children with macrolide-unresponsive
Mycoplasma pneumoniae
pneumonia and establishment of a nomogram model
Objective To investigate the risk factors for plastic bronchitis (PB) in children with macrolide-unresponsive
Mycoplasma pneumoniae
pneumonia (MUMPP) and to establish a nomogram prediction model. Methods A retrospective analysis was conducted on 178 children with MUMPP who underwent bronchoscopy from January to December 2023. According to the presence or absence of PB, the children were divided into a PB group (49 children) and a non-PB group (129 children). The predictive factors for the development of PB in children with MUMPP were analyzed, and a nomogram prediction model was established. The model was assessed in terms of discriminatory ability, accuracy, and clinical effectiveness. Results The multivariate logistic regression analysis showed that older age and higher levels of lactate dehydrogenase and fibrinogen were closely associated with the development of PB in children with MUMPP (
P
<0.05). A nomogram model established based on these factors had an area under the receiver operating characteristic curve of 0.733 (95%
CI
: 0.651-0.816,
P
<0.001) and showed a good discriminatory ability. The Hosmer-Lemeshow goodness-of-fit test indicated that the predictive model had a good degree of fit (
P
>0.05), and the decision curve analysis showed that the model had a good clinical application value. Conclusions The risk nomogram model established based on age and lactate dehydrogenase and fibrinogen levels has good discriminatory ability, accuracy, and predictive efficacy for predicting the development of PB in children with MUMPP.
2025 Vol. 27 (1): 62-67 [
Abstract
] (
1371
) [
HTML
1KB] [
PDF
1026KB] (
732
)
68
XU Huan, WU Chen-Chen, TANG Ji-Hong, FENG Jun, XIAO Xiao, SHI Xiao-Yan, MEI Dao-Qi
Clinical characteristics and long-term follow-up study of basal ganglia infarction after minor head trauma in infants and young children
Objective To investigate the clinical characteristics and prognosis of infants and young children with basal ganglia infarction after minor head trauma (BGIMHT). Methods A retrospective analysis was conducted on the clinical data and follow-up results of children aged 28 days to 3 years with BGIMHT who were hospitalized at Children's Hospital of Soochow University from January 2011 to January 2022. Results A total of 45 cases of BGIMHT were included, with the most common symptom being limb movement disorders (96%, 43/45), followed by facioplegia (56%, 25/45). Cerebral imaging showed that 72% (31/43) had infarction accompanied by basal ganglia calcification. After conservative treatment, 42 children (93%) showed significant symptom improvement, while 3 children (7%) experienced recurrent strokes. The median follow-up time was 82 months (range: 17-141 months). At the last follow-up, 97% (29/30) had residual basal ganglia softening lesions. Among 29 cases participating in questionnaire follow-up, 66% (19/29) recovered normally, 17% (5/29) showed significant improvement in symptoms, and 17% (5/29) had poor improvement. According to the grading of the Global Burden of Disease Control Projects, only 1 child (3%) had severe sequelae. There were no significant differences in age at onset, gender, or presence of concomitant basal ganglia calcification between children with and without neurological sequelae (
P
>0.05). Conclusions The most common initial symptom of BGIMHT is limb movement disorder, and imaging results indicate that most children have concurrent intracranial calcifications. Most infarct lesions later transform into softening lesions, resulting in a generally good prognosis.
2025 Vol. 27 (1): 68-74 [
Abstract
] (
1347
) [
HTML
1KB] [
PDF
1381KB] (
747
)
75
HUANG Yi-Xu, HUANG Yu, PI Guang-Huan
Development of a predictive scoring model for non-response to intravenous immunoglobulin in Kawasaki disease
Objective To explore the predictive factors for non-response to intravenous immunoglobulin (IVIG) in children with Kawasaki disease (KD) and to establish an IVIG non-response prediction scoring model for the Sichuan region. Methods A retrospective study was conducted by collecting clinical data from children with KD admitted to four tertiary hospitals in Sichuan Province between 2019 and 2023. Among them, 940 children responded to IVIG, while 74 children did not respond. Multivariate logistic regression analysis was used to identify the predictive factors for non-response to IVIG and to establish a predictive scoring model. The model's effectiveness was assessed using the receiver operating characteristic curve (ROC) and validated with an independent dataset. Results Multivariate logistic regression analysis showed that the platelet-to-lymphocyte ratio (PLR), hemoglobin (Hb), serum creatinine, aspartate aminotransferase (AST), and platelet count (PLT) were closely related to non-response to IVIG in children with KD (
P
<0.05). Based on these indicators, a predictive scoring model was established: PLR > 199, 0.4 points; Hb ≤ 116 g/L, 4 points; AST > 58 U/L, 0.2 points; serum creatinine > 38 μmol/L, 3.9 points; PLT count ≤ 275 × 10
9
/L, 0.3 points. Using this model, children with KD were scored, and a total score greater than 4.3 was considered high risk of non-response to IVIG. The sensitivity of the model in predicting non-response to IVIG was 77.0%, specificity was 65.7%, and the area under the ROC curve was 0.746 (95%
CI
: 0.688-0.805). Conclusions The predictive scoring model based on PLR, Hb, serum creatinine, AST, and PLT demonstrates good predictive performance for non-response to IVIG in children with KD in the Sichuan region and can serve as a reference for clinical decision-making.
2025 Vol. 27 (1): 75-81 [
Abstract
] (
1272
) [
HTML
1KB] [
PDF
618KB] (
498
)
82
ZHANG Jun, LIN Xiao-Fei, WU Yun-Duo, ZHU Hong-Li, LIU Juan
Expression of soluble factor-related apoptosis ligand in peripheral blood and microRNA-147b in monocytes in children with sepsis and their association with prognosis
Objective To investigate the expression of soluble factor-related apoptosis ligand (sFasL) in peripheral blood and microRNA-147b (miR-147b) in monocytes in children with sepsis and their value in assessing prognosis. Methods A prospective study was conducted on 124 children with sepsis (sepsis group), 60 children with common infections (infection group), and 60 healthy children undergoing physical examinations (healthy control group). The independent risk factors for poor prognosis in children with sepsis were analyzed, and the value of serum sFasL and monocyte miR-147b in predicting poor prognosis in children with sepsis was assessed. Results The serum level of sFasL and the relative expression of miR-147b in monocytes were highest in the sepsis group, followed by the infection group and the healthy control group (
P
<0.05). The multivariate logistic regression analysis showed that the serum level of sFasL and the relative expression of miR-147b in monocytes were closely associated with the poor prognosis of children with sepsis (
P
<0.05). The receiver operating characteristic curve analysis showed that the combination of serum sFasL level and relative expression of miR-147b in monocytes had a larger area under the curve compared to each indicator alone in predicting the prognosis of children with sepsis (
P
<0.05). Conclusions There are significant increases in the level of sFasL in peripheral blood and the relative expression of miR-147b in monocytes in children with sepsis. The combined use of these two indicators has relatively high clinical value in assessing the prognosis of children with sepsis.
2025 Vol. 27 (1): 82-87 [
Abstract
] (
1450
) [
HTML
1KB] [
PDF
647KB] (
498
)
88
ZHU Ping, QI Wen-Jing, TAO Ye-Qing, CUI Ding-Ding, SHENG Guang-Yao, WANG Chun-Mei
Clinical characteristics and prognosis of acute erythroleukemia in children
Objective To investigate the clinical characteristics and prognosis of acute erythroleukemia (AEL) in children. Methods A retrospective analysis was conducted on the clinical data, treatment, and prognosis of 8 children with AEL treated at the First Affiliated Hospital of Zhengzhou University from January 2013 to December 2023. Results Among the 7 patients with complete bone marrow morphological analysis, 4 exhibited trilineage dysplasia, with a 100% incidence of erythroid dysplasia (7/7), a 71% incidence of myeloid dysplasia (5/7), and a 57% incidence of megakaryocytic dysplasia (4/7). Immunophenotyping revealed that myeloid antigens were primarily expressed as CD13, CD33, CD117, CD38, and CD123, with 4 cases expressing erythroid antigens CD71 and 2 cases expressing CD235a. Chromosomal analysis indicated that 2 cases presented with abnormal karyotypes, including +8 in one case and +4 accompanied by +6 in another; no complex karyotypes were observed. Genetic abnormalities were detected in 4 cases, with fusion genes including one case each of
dup MLL
positive and
EVI1
positive, as well as mutations involving
KRAS
,
NRAS
,
WT1
, and
UBTF
. Seven patients received chemotherapy, with 6 achieving remission after one course of treatment; 2 underwent hematopoietic stem cell transplantation, and all had disease-free survival. Follow-up (median follow-up time of 6 months) showed that only 3 patients survived (2 cases after hematopoietic stem cell transplantation and 1 case during treatment). Conclusions Children with AEL have unique clinical and biological characteristics, exhibit poor treatment response, and have a poor prognosis; however, hematopoietic stem cell transplantation may improve overall survival rates.
2025 Vol. 27 (1): 88-93 [
Abstract
] (
1525
) [
HTML
1KB] [
PDF
542KB] (
677
)
94
YE Juan, YE Feng, HOU Ling, WU Wei, LUO Xiao-Ping, LIANG Yan
Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood
Objective To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. Methods A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. Results All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (
GCK
) gene, with Cases 6 (
GCK
c.1047C>A, p.Y349X), 11 (
GCK
c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (
GCK
c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. Conclusions This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
2025 Vol. 27 (1): 94-100 [
Abstract
] (
1313
) [
HTML
1KB] [
PDF
852KB] (
661
)
EXPERIMENTAL RESEARCH
101
LIAO Jin-Wen, GUO Xin, LIANG Bo, LI Xu-Xia, XU Ming-Guo
Berberine ameliorates coronary artery endothelial cell injury in Kawasaki disease through complement and coagulation cascades
Objective To explore the role of berberine (BBR) in ameliorating coronary endothelial cell injury in Kawasaki disease (KD) by regulating the complement and coagulation cascade. Methods Human coronary artery endothelial cells (HCAEC) were divided into a healthy control group, a KD group, and a BBR treatment group (
n
=3 for each group). The healthy control group and KD group were supplemented with 15% serum from healthy children and KD patients, respectively, while the BBR treatment group received 15% serum from KD patients followed by the addition of 20 mmol/L BBR. Differential protein expression was analyzed and identified using isobaric tags for relative and absolute quantitation technology and liquid chromatography-tandem mass spectrometry, followed by GO functional enrichment analysis and KEGG signaling pathway enrichment analysis of the differential proteins. Western blot was used to detect differential protein expression. Results A total of 518 differential proteins were identified between the KD group and the healthy control group (300 upregulated proteins and 218 downregulated proteins). A total of 422 differential proteins were identified between the BBR treatment group and the KD group (221 upregulated proteins and 201 downregulated proteins). Bioinformatics analysis showed that compared to the healthy control group, the differential proteins in the KD group were enriched in the complement and coagulation cascade and ribosome biogenesis in eukaryotes. Compared to the KD group, the differential proteins in the BBR treatment group were also enriched in the complement and coagulation cascade and ribosome biogenesis in eukaryotes. Western blot results indicated that compared to the healthy control group, the expression of complement C1q subcomponent subunit C (C1QC), kininogen-1 (KNG1), complement C1s subcomponent (C1S), and C4b-binding protein alpha chain (C4BPA) was increased in the KD group (
P
<0.05). Compared to the KD group, the expression of KNG1, C1S, C1QC, and C4BPA was decreased in the BBR treatment group (
P
<0.05). Conclusions The complement and coagulation cascade may be involved in the regulation of BBR treatment for coronary injury in KD, and C1QC, KNG1, C1S, and C4BPA may serve as biomarkers for this treatment.
2025 Vol. 27 (1): 101-108 [
Abstract
] (
949
) [
HTML
1KB] [
PDF
1016KB] (
735
)
REVIEW
109
YAO Ke-Ke, WANG Huan, YANG Zhen-Zhen
Research advances in reward positivity and internalizing and externalizing problems in children and adolescents
Adolescence is a critical period for the development of the reward circuit, and reward positivity (RewP) is one of the electrophysiological indicators reflecting reward processing. Many studies have shown that abnormalities in RewP is closely associated with internalizing and externalizing problems in children and adolescents. In addition, factors such as stressful life events and sleep disorders can affect reward-related brain activity and increase the risk of various psychopathological problems in this population. The article reviews the characteristics of changes in RewP among children and adolescents with various internalizing and externalizing problems in recent years, aiming to provide a reference for the basic research on the pathogenesis of these issues and to identify new targets for clinical diagnosis and treatment.
2025 Vol. 27 (1): 109-114 [
Abstract
] (
841
) [
HTML
1KB] [
PDF
501KB] (
629
)
115
ZHOU Ying-Zhen, WANG Ting, FU Xing-Meng, PENG Bing-Ming, FU Zhou
Prognosis of bronchopulmonary dysplasia
Children with bronchopulmonary dysplasia (BPD) often exhibit severe respiratory problems and significant pulmonary dysfunction during school age and adulthood. Exercise tests show a decline in cardiopulmonary function and physical performance in children with BPD, who also have a higher incidence of pulmonary hypertension. These children generally perform poorly in terms of intelligence, language, and motor development. As they age, the risk of neurodevelopmental disorders increases, and health-related quality of life is also affected. This article reviews the prognosis of the respiratory system, physical capacity, cardiovascular system, nervous system, and health-related quality of life in children with BPD, aiming to improve the management of these patients and enhance their subsequent quality of life.
2025 Vol. 27 (1): 115-120 [
Abstract
] (
1122
) [
HTML
1KB] [
PDF
521KB] (
715
)
121
GENG Hui-Yun, WANG Zhi-Hua
Research advances in maturity-onset diabetes of the young
Maturity-onset diabetes of the young (MODY) is a special type of diabetes characterized by clinical features including early onset of diabetes (before 30 years of age), autosomal dominant inheritance, impaired glucose-induced insulin secretion, and hyperglycemia. So far, 14 types of MODY have been reported, accounting for about 1%-5% of the patients with diabetes. MODY often presents with an insidious onset, and although 14 subtypes have been identified for MODY, it is frequently misdiagnosed as type 1 or type 2 diabetes due to overlapping clinical features and high costs and limitations of genetic testing. This article reviews the clinical features of MODY subtypes in order to improve the accuracy of the diagnosis and treatment of MODY.
2025 Vol. 27 (1): 121-126 [
Abstract
] (
1140
) [
HTML
1KB] [
PDF
570KB] (
721
)
127
LEI Shi-Yi, LI Chen-Yang, LIU Ling-Juan, YUAN Yu-Xing, TIAN Jie
Research progress on the diagnosis of pediatric heart failure
Heart failure is a complex clinical syndrome and pediatric heart failure (PHF) has a high mortality rate. Early diagnosis is crucial for treatment and management of PHF. In clinical practice, various tests and examinations play a key role in the diagnosis of PHF, including continuously updated biomarkers, echocardiography, and cardiac magnetic resonance imaging. This article focuses on summarizing relevant research on biomarkers, examinations, combined testing, clinical models, and the grading and staging of PHF diagnosis, aiming to provide insights and directions for the diagnosis of PHF.
2025 Vol. 27 (1): 127-132 [
Abstract
] (
990
) [
HTML
1KB] [
PDF
592KB] (
692
)
CJCP
About Journal
Editors members
Contact Us
Copyright © 2004-2005 Chinese Journal Of Contemporary Pediatrics All rights reserved.
Addr: 87 Xiangya Road, Changsha, Hunan, 410008, PRC
Tel: 0731-84327402 Fax: 0731-84327922 E-mail: cjcp1999@csu.edu.cn